993 resultados para Orsini, Fulvio, 1529-1600
Resumo:
The first convergent synthesis of the tricyclic skeleton of huperzine A is described and includes, as the key step, an efficient regioselective intramolecular Heck reaction of 2-(tert-butyldimethylsillyoxymethyl)-6-(2-methoxy-5-bromopyridin-6-yl)methylcyclohex-2-enol.
Resumo:
A simple method to predict the densities of a range of ionic liquids from their surface tensions, and vice versa, using a surface-tension-weighted molar volume, the parachor, is reported. The parachors of ionic liquids containing 1-alkyl-3-methylimidazolium cations were determined experimentally, but were also calculated directly from their structural compositions using existing parachor contribution data for neutral compounds. The calculated and experimentally determined parachors were remarkably similar, and the latter data were subsequently employed to predict the densities and surface tensions of the investigated ionic liquids. Using a similar approach, the molar refractions of ionic liquids were determined experimentally, as well as calculated using existing molar refraction contribution data for uncharged compounds. The calculated molar refraction data were employed to predict the refractive indices of the ionic liquids from their surface tensions. The errors involved in the refractive index predictions were much higher than the analogous predictions employing the parachor, but nevertheless demonstrated the potential for developing parachor and molar refraction contribution data for ions as tools to predict ionic liquid physical properties.
Resumo:
The synthesis of [Rh-2(COD)(2)(dppm)(mu(2)-Cl)] BF4 (1) (COD) 1,5-cyclooctadiene, dppm) bis(diphenylphosphino) methane) from simple precursors is reported. This is a rare example of a dirhodium complex with an open [Rh-2(mu(2)-dppm)(mu(2)-Cl)] core. The complex has been used to affect the hydrogenation of styrene and benzo[b] thiophene with total selectivity and competitive rates of reaction. The recycling of the catalyst has been achieved by the entrapment of 1 in silica by a sol-gel method to produce a recyclable solid catalyst.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
A series of 2-, 3- and 4-substituted pyridines was metabolised using the mutant soil bacterium Pseudomonas putida UV4 which contains a toluene dioxygenase (TDO) enzyme. The regioselectivity of the biotransformation in each case was determined by the position of the substituent. 4-Alkylpyridines were hydroxylated exclusively on the ring to give the corresponding 4-substituted 3-hydroxypyridines, while 3-alkylpyridines were hydroxylated stereoselectively on C-1 of the alkyl group with no evidence of ring hydroxylation. 2-Alkylpyridines gave both ring and side-chain hydroxylation products. Choro- and bromo-substituted pyridines, and pyridine itself, while being poor substrates for P. putida UV4, were converted to some extent to the corresponding 3-hydroxypyridines. These unoptimised biotransformations are rare examples of the direct enzyme-catalysed oxidation of pyridine rings and provide a novel synthetic method for the preparation of substituted pyridinols. Evidence for the involvement of the same TDO enzyme in both ring and side-chain hydroxylation pathways was obtained using a recombinant strain of Escherichia coli (pKST11) containing a cloned gene for TDO. The observed stereoselectivity of the side-chain hydroxylation process in P. putida UV4 was complicated by the action of an alcohol dehydrogenase enzyme in the organism which slowly leads to epimerisation of the initial (R)-alcohol bioproducts by dehydrogenation to the corresponding ketones followed by stereoselective reduction to the (S)-alcohols.
Resumo:
Biotransformations of a series of ortho-, meta- and para-substituted ethylbenzene and propylbenzene substrates have been carried out, using Pseudomonas putida UV4, a source of toluene dioxygenase (TDO). The ortho- and para-substituted alkylbenzene substrates yielded, exclusively, the corresponding enantiopure cis-dihydrodiols of the same absolute configuration. However, the meta isomers, generally, gave benzylic alcohol bioproducts, in addition to the cis-dihydrodiols (the meta effect). The benzylic alcohols were of identical (R) absolute configuration but enantiomeric excess values were variable. The similar (2R) absolute configurations of the cis-dihydrodiols are consistent with both the ethyl and propyl groups having dominant stereodirecting effects over the other substituents. The model used earlier, to predict the regio- and stereo-chemistry of cis-dihydrodiol bioproducts derived from substituted benzene substrates has been refined, to take account of non-symmetric subsituents like ethyl or propyl groups. The formation of benzylic hydroxylation products, from meta-substituted benzene substrates, without further cis-dihydroxylation to yield triols provides a further example of the meta effect during toluene dioxygenase-catalysed oxidations.