850 resultados para Constructed Preferences


Relevância:

10.00% 10.00%

Publicador:

Resumo:

A mutant version of the N-terminal domain of Escherichia coli DnaB helicase was used as a model system to assess the stabilization against unfolding gained by covalent cyclization. Cyclization was achieved in vivo by formation of an amide bond between the N and C termini with the help of a split mini-intein. Linear and circular proteins were constructed to be identical in amino acid sequence. Mutagenesis of Phe102 to Glu rendered the protein monomeric even at high concentration. A difference in free energy of unfolding, DeltaDeltaG, between circular and linear protein of 2.3(+/-0.5) kcal mol(-1) was measured at 10degreesC by circular dichroism. A theoretical estimate of the difference in conformational entropy of linear and circular random chains in a three-dimensional cubic lattice model predicted DeltaDeltaG = 2.3 kcal mol(-1), suggesting that stabilization by protein cyclization is driven by the reduced conformational entropy of the unfolded state. Amide-proton exchange rates measured by NMR spectroscopy and mass spectrometry showed a uniform, approximately tenfold decrease of the exchange rates of the most slowly exchanging amide protons, demonstrating that cyclization globally decreases the unfolding rate of the protein. The amide proton exchange was found to follow EX1 kinetics at near-neutral pH, in agreement with an unusually slow refolding I measured by stopped-flow circular dichroism. rate of less than 4 min(-1) The linear and circular proteins differed more in their unfolding than in their folding rates. Global unfolding of the N-terminal domain of E. coli DnaB is thus promoted strongly by spatial separation of the N and C termini, whereas their proximity is much less important for folding. (C) 2005 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The elevated plus-maze is an animal model of anxiety used to study the effect of different drugs on the behavior of the animal It consists of a plus-shaped maze with two open and two closed arms elevated 50 cm from the floor The standard measures used to characterize exploratory behavior in the elevated plus-maze are the time spent and the number of entries in the open arms In this work we use Markov chains to characterize the exploratory behavior of the rat in the elevated plus-maze under three different conditions normal and under the effects of anxiogenic and anxiolytic drugs The spatial structure of the elevated plus-maze is divided into squares which are associated with states of a Markov chain By counting the frequencies of transitions between states during 5-min sessions in the elevated plus-maze we constructed stochastic matrices for the three conditions studied The stochastic matrices show specific patterns which correspond to the observed behaviors of the rat under the three different conditions For the control group the stochastic matrix shows a clear preference for places in the closed arms This preference is enhanced for the anxiogenic group For the anxiolytic group the stochastic matrix shows a pattern similar to a random walk Our results suggest that Markov chains can be used together with the standard measures to characterize the rat behavior in the elevated plus-maze (C) 2010 Elsevier B V All rights reserved

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We introduce biomimetic in silico devices, and means for validation along with methods for testing and refining them. The devices are constructed from adaptable software components designed to map logically to biological components at multiple levels of resolution. In this report we focus on the liver; the goal is to validate components that mimic features of the lobule (the hepatic primary functional unit) and dynamic aspects of liver behavior, structure, and function. An assembly of lobule-mimetic devices represents an in silico liver. We validate against outflow profiles for sucrose administered as a bolus to isolated, perfused rat livers. Acceptable in silico profiles are experimentally indistinguishable from those of the in situ referent. This new technology is intended to provide powerful Dew tools for challenging our understanding of how biological functional units function in vivo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The object of this study is to assess informative possibilities of some technical indicators of the Test of Photos of Professions (BBT - Berufsbilder test), a projective method to clarify professional inclination, proposed by Martin Achtnich. This psychological evaluation technique is composed of 96 photos of professionals, performing various types of activities. The test subject classifies the photos into three groups: positive (agreeable), negative (disagreeable) and indifferent (neutral). Among those chosen positively, five preferences are chosen and a story is developed that includes them, an activity that is requested two times during the Vocational Guidance process: in the beginning (or middle) and at the end of the intervention. In this study, 160 stories were created by 80 youths, between 15 and 20 years of age, in public and private schools in a mid-sized Brazilian city. The stories were compared in three analytical categories: protagonist, professional conflict and resolution. The results were submitted to Wilcoxon nonparametric statistical analysis (p < .05), significant and relevant indicators of resolution being found in the process of occupational choice. This technical resource was shown, from this empirical evidence, to be promising for use in evaluation of intervention processes of Vocational Guidance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose: To study the oculometric parameters of hyperopia in children with esotropic amblyopia, comparing amblyopic eyes with fellow eyes. Methods: Thirty-seven patients (5-8 years old) with bilateral hyperopia and esotropic amblyopia underwent a comprehensive ophthalmic examination, including cycloplegic refraction, keratometry and A-scan ultrasonography. Anterior chamber depth, lens thickness, vitreous chamber depth and total axial length were recorded. The refractive power of the crystalline lens was calculated using Bennett`s equations. Paired Student`s t-tests were used to compare ocular biometric measurements between amblyopic eyes and their fellow eyes. The associations of biometric parameters with refractive errors were assessed using Pearson correlation coefficients and linear regression. Multivariable models including axial length, corneal power and lens power were also constructed. Results: Amblyopic eyes were found to have significantly more hyperopic refraction, less corneal power, greater lens power, shorter vitreous chamber depth and shorter axial length, despite similar anterior chamber depth and lens thickness. The strongest correlation with refractive error was observed for the axial length/corneal radius ratio (r(36) = -0.92, p < 0.001 for amblyopic and r(36) = 0.87, p < 0.001 for fellow eyes). Axial length accounted for 39.2% (R(2)) of the refractive error variance in amblyopic eyes and 35.5% in fellow eyes. Adding corneal power to the model increased R(2) to 85.7% and 79.6%, respectively. A statistically significant correlation was found between axial length and corneal power, indicating decreasing corneal power with increasing axial length, and they were similar for amblyopic eyes (r(36) = 0.53,p < 0.001) and fellow eyes (r(36) = -0.57, p < 0.001). A statistically significant correlation was also found between axial length and lens power, indicating decreasing lens power with increasing axial length (r(36) = -0.72, p < 0.001 for amblyopic eyes and r(36) = -0.69, p < 0.001 for fellow eyes). Conclusions: We observed that the correlation among the major oculometric parameters and their individual contribution to hyperopia in esotropic children were similar in amblyopic and non-amblyopic eyes. This finding suggests that the counterbalancing effect of greater corneal and lens power associated with shorter axial length is similar in both eyes of patients with esotropic amblyopia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Understanding the role of multiple colour signals during sexual signalling is a central theme in animal communication. We quantified the role of multiple colour signals (including ultraviolet, UV), measures of body size and testosterone levels in settling disputes between male rivals in an elaborately ornamented, African lizard, played out in a large 'tournament' in the wild. The hue and brightness (total reflectance) of the UV throat in Augrabies flat lizards, Platysaurus broadleyi, as well as body size, were consistent and strong predictors of 'fighting ability'. Males with high fighting ability were larger and displayed a UV throat with low total reflectance. In contrast, males with low fighting ability were smaller and had violet throats with broader spectral reflectance curves (higher total reflectance). As fighting ability is associated with alternative reproductive tactics in this system (territorial versus floater), we also examined the role of colour signals in predicting male reproductive tactic. Territorial males had UV throats with higher chroma but had poorer body condition than floater males, probably because of the energetic costs of maintaining a territory. Although testosterone was not a significant predictor of fighting ability or reproductive tactic, it was correlated with the hue of the UV throat, suggesting that testosterone may impose some constraint on signal expression. Lastly, we show that within the context of the natural signalling environment, UV-reflective throats constitute a conspicuous, effective signal that male Augrabies flat lizards use to advertise their status honestly to rivals. (c) 2006 The Association for the Study of Animal Behaviour. Published by Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It is shown that quasigroups constructed using the standard construction from 2-perfect directed m-cycle systems are precisely the finite members of a variety if and only if m=3, 4 or 5.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The refinement calculus provides a framework for the stepwise development of imperative programs from specifications. In this paper we study a refinement calculus for deriving logic programs. Dealing with logic programs rather than imperative programs has the dual advantages that, due to the expressive power of logic programs, the final program is closer to the original specification, and each refinement step can achieve more. Together these reduce the overall number of derivation steps. We present a logic programming language extended with specification constructs (including general predicates, assertions, and types and invariants) to form a wide-spectrum language. General predicates allow non-executable properties to be included in specifications. Assertions, types and invariants make assumptions about the intended inputs of a procedure explicit, and can be used during refinement to optimize the constructed logic program. We provide a semantics for the extended logic programming language and derive a set of refinement laws. Finally we apply these to an example derivation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Insulin-like growth factor I has similar mitogenic effects to insulin, a growth factor required by most cells in culture, and it can replace insulin in serum-free formulations for some cells. Chinese Hamster Ovary cells grow well in serum-free medium with insulin and transferrin as the only exogenous growth factors. An alternative approach to addition of exogenous growth factors to serum-free medium is transfection of host cells with growth factor-encoding genes, permitting autocrine growth. Taking this approach, we constructed an IGF-I heterologous gene driven by the cytomegalovirus promoter, introduced it into Chinese Hamster Ovary cells and examined the growth characteristics of Insulin-like growth factor I-expressing clonal cells in the absence of the exogenous factor. The transfected cells secreted up to 500 ng/10(6) cells/day of mature Insulin-like growth factor I into the conditioned medium and as a result they grew autonomously in serum-free medium containing transferrin as the only added growth factor. This growth-stimulating effect, observed under both small and large scale culture conditions, was maximal since no further improvement was observed in the presence of exogenous insulin.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The large number of wetlands treating mining wastewaters around the world have mostly been constructed in temperate environments. Wetlands have yet to be proven in low rainfall, high evaporation environments and such conditions are common in many parts of Australia. BHP Australia Coal is researching whether wetlands have potential in central Queensland to treat coal mining wastewaters. In this region, mean annual rainfall is < 650 mm and evaporation > 2 000 mm. A pilot-scale wetland system has been constructed at an open-cut coal mine. The system comprises six treatment cells, each 125 m long and 10 m wide. The system is described in the paper and some initial results presented. Results over the first fourteen months of operation have shown that although pH has not increased enough to enable reuse or release of the water, sulfate reduction has been observed in parts of the system, as shown by the characteristic black precipitate and smell of hydrogen sulfide emanating from the wetlands. These encouraging signs have led to experiments aimed at identifying the factors limiting sulfate reduction. The first experiment, described herein, included four treatments where straw was overlain by soil and the water level varied, being either at the top of the straw, at the top of the soil, or about 5 cm above the soil. The effect of inoculating with sulfate-reducing bacteria was investigated. Two controls were included, one covered and one open, to enable the effect of evaporation to be determined. The final treatment consisted of combined straw/cattle manure overlain with soil. Results showed that sulfate reduction did occur, as demonstrated by pH increases and lowering of sulfate levels. Mean pH of the water was significantly higher after 19 days; in the controls, pH was < 3.3, whereas in the treatments, pH ranged from 5.4 to 6.7. The best improvement in sulfate levels occurred in the straw/cattle manure treatment. (C) 1997 IAWQ. Published by Elsevier Science Ltd.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We present an anisotropic correlated electron model on a periodic lattice, constructed from an R-matrix associated with the Temperley-Lieb algebra. By modification of the coupling of the first and last sites we obtain a model with quantum algebra invariance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To describe the incidence of cancer in coal miners in New South Wales (NSW) between 1973 and 1992, an inception cohort of all male coal industry employees who entered the industry between 1 January 1973 and 31 December 1992 was constructed from the medical examination records of the Joint Coal Board. This cohort was matched with the NSW State Cancer Registry to determine the occurrence and type of cancer. In the cohort of 23 630 men, 297 developed 301 primary cancers in the 20-year period of observation. The standardised incidence ratio (SLR) for all cancers was 0.82. Stomach cancer has been reported to be common in coal miners but the SIR for stomach cancer was not higher than average in this cohort. A cluster of non-Hodgkin's lymphoma has been reported in a NSW coal mine but an increased risk of this cancer was not evident in the industry as a whole. Similarly a cluster of cases of brain tumour has been reported. In this cohort, the SIR for brain tumour was 1.05 (95 per cent confidence interval (CI) 0.57 to 1.76) and a risk for brain tumour remains unconfirmed. The SIR for malignant melanoma was 1.13 (CI 0.90 to 1.39) altogether and 2.02 (CI 1.31 to 2.98) for those workers who started in an open-cut mine. Overall, there does not appear to be a general risk of cancer in the NSW coal industry. Open-cut miners have an increased risk of malignant melanoma, which may be related to their exposure to the sun at work.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A free-piston driver that employs entropy-raising shock processes with diaphragm rupture has been constructed, which promises significant theoretical advantages over isentropic compression. Results from a range of conditions with helium and argon driver gases are reported. Significant performance gains were achieved in some test cases. Heat losses are shown to have a strong effect on driver processes. Measurements compare well with predictions from a quasi-one-dimensional numerical code.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A full set of (higher-order) Casimir invariants for the Lie algebra gl(infinity) is constructed and shown to be well defined in the category O-FS generated by the highest weight (unitarizable) irreducible representations with only a finite number of nonzero weight components. Moreover, the eigenvalues of these Casimir invariants are determined explicitly in terms of the highest weight. Characteristic identities satisfied by certain (infinite) matrices with entries from gl(infinity) are also determined and generalize those previously obtained for gl(n) by Bracken and Green [A. J. Bracken and H. S. Green, J. Math. Phys. 12, 2099 (1971); H. S. Green, ibid. 12, 2106 (1971)]. (C) 1997 American Institute of Physics.