942 resultados para sugar catabolite repression


Relevância:

10.00% 10.00%

Publicador:

Resumo:

In the last few years the sugar-cane mechanical harvested area has increased, especially in regions with appropriated slop. The use of this technology brings some inconveniences, such as, the increase in the percentage of extraneous matter, which causes the reduction of technological quality of the raw material, and losses in the field. Extraneous matter (trash) is composed of tops and leaves in major percentage, plus soil and roots, and eventually some metal parts. In the green cane harvest system the percentage of extraneous matter has a tendency to increase due to the great amount of vegetal matter to be processed. The increase in the blower fan speed to reduce the amount of extraneous matter can lead to an unacceptable economic level of raw material losses. The main objective of this work was, using a cane loss monitor, to evaluate and quantify the amount of visible losses of sugar cane through the primary extractor at two different fan speeds. Afterwards these losses were related to the harvester cleaning efficiency. The piezoelectric transducer shows a reasonable sensibility. The results show that the cleaning efficiency in the primary extractor (85% mean), the cane losses (between 5.68% and 2.15%) and fan speed are interrelated. The total losses and specially splinters (between 3.19% and 0.91%), showed a significant difference among the treatments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A base-cutter represented for a mechanism of four bars, was developed using the Autocad program. The normal force of reaction of the profile in the contact point was determined through the dynamic analysis. The equations of dynamic balance were based on the laws of Newton-Euler. The linkage was subject to an optimization technique that considered the peak value of soil reaction force as the objective function to be minimized while the link lengths and the spring constant varied through a specified range. The Algorithm of Sequential Quadratic Programming-SQP was implemented of the program computational Matlab. Results were very encouraging; the maximum value of the normal reaction force was reduced from 4,250.33 to 237.13 N, making the floating process much less disturbing to the soil and the sugarcane rate. Later, others variables had been incorporated the mechanism optimized and new otimization process was implemented .

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Inulin is a fructooligosacharide found in diverse agricultural products, amongst them garlic, banana, Jerusalem artichoke and chicory root. Inulin generally is used in developed countries, as a substitute of sugar and/or fat due to its characteristics of fitting as functional and dietary food. Chicory root is usually used as source and raw material for commercial extration of inulin. The experiments consisted on drying sliced chicory roots based on a factorial experimental design in a convective dryer whose alows the air to pass perpendicularly through the tray. Effective diffusivity (dependent variable) has been determined for each experimental combination of independent variables (air temperature and velocity). The data curves have been fitted by the solution of the second Fick law and Page's model. Effective difusivity varied from 3.51 x 10-10 m² s-1 to 1.036 x 10-10 m² s-1. It is concluded that, for the range of studied values, air temperature is the only statistically significant variable. So, a first order mathematical model was obtained, representing effective diffusivity behavior as function of air temperature. The best drying condition was correspondent to the trial using the highest drying air temperature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Civil society and sugarcane farmer demands indicate that harvesting technology has enough limitations to jeopardize production in large sugar cane producing areas. This work analyses the current mechanical harvesting compared to a semi-mechanical harvesting proposal, on the bases of eleven characteristics considered determinant for a quick spreading of green cane harvesting on hilly areas, with lower impact on agricultural labor and farmers investment capacity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this work the performance of a sugar cane chopped harvester was analysed when fed with two sugar cane mass flows, measuring the invisible losses, which are impossible to measure in the field, harvester sugar cane cleaning efficiency and air velocity on extractors exit. The trial was done under controlled conditions at Copersucar Technology Center in January 2000. The results showed that the flow of sugar cane through the harvester doesn't influence the magnitudes of total invisible losses and raw material cleaning efficiency. The mean air velocity on the primary extractors exit was 12.0 m s-1, and 9.2 m s-1 on the secondary extractor, with a coefficient of variation of 21%, indicating that the poor cleaning performance of the harvester could be related to air velocity difference inside the extractor. Analyzing the data collected in the trials, it was possible to conclude that invisible losses in sugar cane harvester were 10% and the cleaning efficiency was 87%.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Myelomeningocele (MMC) is a congenital malformation of the neural tube that occurs in the first weeks of pregnancy. This malformation refers to the caudal non-closure of the neural tube and neural tissue exposure, which lead to neurological problems, such as hydrocephalus, motor disability, genitourinary tract and skeletal abnormalities and mental retardation. Patients with MMC have an acknowledged predisposition to latex allergy and are usually at a high caries risk and activity due to poor oral hygiene, fermentable carbon hydrate-rich diet and prolonged use of sugar-containing medications. This paper addresses the common oral findings in pediatric patients with MMC, discusses the strategies and precautions to deal with these individuals and reports the dental care to a young child diagnosed with this condition.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aims of this study were to evaluate the incidence of mutans streptococci (MS - sessile form) on complete maxillary dentures after use of a specific denture paste, and to determine the minimum inhibitory concentration (MIC) and maximum inhibitory dilution (MID) of 3 oral mouthrinses: Cepacol, Plax and Periogard. Seventy-seven complete denture wearers were randomly assigned into 2 groups, according to the product used for denture cleaning: Control group - conventional dentifrice (Kolynos-Super White); and Test group: experimental denture cleaning paste. Denture biofilm was collected at baseline and after 90 and 180 days after treatment by brushing the dentures with saline solution. After decimal serial dilution, samples were seeded onto agar sucrose bacitracin to count colonies with morphological characteristics of MS. MS identification was performed by the sugar fermentation tests. After this procedure, brain heart infusion broth (BHI) was added to oral mouthrinses (Plax, Cepacol e Periogard) and seeded on Petri dishes. The colonies were seeded using the Steers multiplier and, after the incubation, the MIC and MID of the mouthrinses were calculated. The results showed an incidence of 74.0% (n=57) of MS in the 77 complete dentures examined in the study, being 76.3% (n=29) of the Control group (conventional dentifrice) and 71.8% (28) of the Test group (experimental denture cleaning paste). In both groups, the number of positive cases for MS decreased from day 0 to day 180. In the Test group there was a slight decrease in the incidence of Streptococcus mutans 90 days after use of the experimental denture cleaning paste, which was not observed in the Control group. As regards to mouthrinses, for both groups, Periogard showed antimicrobial action with the highest dilution, followed by Cepacol and Plax. In conclusion, the incidence of MS in complete dentures was high and Periogard was the mouthrinse with the strongest antimicrobial action against MS. The experimental denture cleaning paste showed a slight action against S. mutans after 90 days of treatment.