Implementação de um algoritmo para a análise de curtos-circuitos de alta impedância baseado no fluxo de carga soma de potências

This work has as main objective to show all the particularities regarding the Three-phase Power Summation Method, used for load flow calculation, in what it says respect to the influence of the magnetic coupling among the phases, as well as to the losses presented in all the existent transformers in the feeder to be analyzed. Besides, its application is detailed in the study of the short-circuits, that happen in the presence of high impedance values, which possess a problem, that is its difficult detection and consequent elimination on the part of common devices of protection. That happens due to the characteristic presented by the current of short¬ circuit, in being generally of the same order of greatness that the load currents. Results of simulations accomplished in several situations will be shown, objectifying a complete analysis of the behavior of the proposed method in several types of short-circuits. Confront of the results obtained by the method with results of another works will be presented to verify its effectiveness

Aplicação prática do método de sintonia de controladores PID utilizando o método do relé com histerese

The area of research and development involving the PID tune of controllers is an active area in the academic and industrial sectors yet. All this due to the wide use of PID controllers in the industry (96% of all controllers in the industry is still PID). Controllers well tuned and tools to monitor their performance over time with the possibility of selftuning, become an item almost obligatory to maintain processes with high productivity and low cost. In a globalized world, it is essential for their self survival. Although there are several new tools and techniques that make PID tune, in this paper will explore the PID tune using the relay method, due its good acceptance in the industrial environment. In addition, we will discuss some techniques for evaluation of control loops, as IAE, ISE, Goodhart, the variation of the control signal and index Harris, which are necessary to propose new tuning for control loops that have a low performance. Will be proposed in this paper a tool for tuning and self tuning PID. Will be proposed in this paper a PID auto-tuning software using a relay method. In particular, will be highlighted the relay method with hysteresis. This method has shown tunings with satisfactory performance when applied to the didactic, simulated and real plants

Simulação numérica da interação entre uma nuvem incidente de vórtices e uma aerofólio através do método dos vórtices

The study of aerodynamic loading variations has many engineering applications, including helicopter rotor blades, wind turbines and turbo machinery. This work uses a Vortex Method to make a lagrangian description of the a twodimensional airfoil/ incident wake vortex interaction. The flow is incompressible, newtonian, homogeneus and the Reynolds Number is 5x105 .The airfoil is a NACA 0018 placed a angle of attack of the 0° and 5°simulates with the Painel Method with a constant density vorticity panels and a generation poit is near the painel. The protector layer is created does not permit vortex inside the body. The vortex Lamb convection is realized with the Euler Method (first order) and Adans-Bashforth (second order). The Random Walk Method is used to simulate the diffusion. The circular wake has 366 vortex all over positive or negative vorticity located at different heights with respect to the airfoil chord. The Lift was calculated based in the algorithm created by Ricci (2002). This simulation uses a ready algorithm vatidated with single body does not have a incident wake. The results are compared with a experimental work The comparasion concludes that the experimental results has a good agrement with this papper

Avaliação da estrutura de tecidos técnicos como elemento reforçante em compósitos poliméricos sistema poliéster isoftálico

Materials known as technical textiles can be defined as structures designed and developed to meet specific functional requirements of various industry sectors, which is the case in automotive and aerospace industries, and other specific applications. Therefore, the purpose of this work presents the development and manufacture of polymer composite with isophthalic polyester resin. The reinforcement of the composite structure is a technical textile fabric made from high performance fibers, aramid (Kevlar 49) and glass fiber E. The fabrics are manufactured by the same method, with the aim of improving the tensile strength of the resulting polymer composite material. The fabrics, we developed some low grammage technical textile structures in laboratory scale and differentiated-composition type aramid (100%), hybrid 1 aramid fiber / glass (65/35%) and hybrid 2 aramid fiber / glass (85/15% ) for use as a reinforcing element in composite materials with unsaturated isophthalic polyester matrix. The polymer composites produced were tested in uniaxial tensile fracture surface and it´s evaluated by SEM. The purpose of this work characterize the performance of polymer composites prepared, identifying changes and based on resistance to strain corresponding to the mechanical behavior. The objectives are to verify the capability of using this reinforcement structure, along with the use of high performance fibers and resin in terms of workability and mechanical strength; verify the adherence of the fiber to the matrix and the fracture surface by electron microscopy scanning and determination of tensile strength by tensile test. The results indicate that, in a comparative study to the response of uniaxial tensile test for tensile strength of the composites and the efficiency of the low percentage of reinforcement element, being a technical textile fabric structure that features characteristic of lightness and low weight added in polymer composites

Melhoramento genético da mamona visando incremento de flores femininas

O objetivo deste trabalho foi testar métodos de seleção visando ao aumento de flores femininas na população FCA-UNESP-PB de mamona (Ricinus communis L.). A seleção foi realizada no município de Botucatu (SP), na safrinha de 2007. Por meio de seleção massal, foram selecionadas plantas com racemo primário estritamente feminino. Destas plantas, as que tinham reversão sexual foram autofecundadas. As avaliações foram realizadas na safrinha de 2008 em Botucatu e São Manuel (SP), onde foram comparados os tratamentos: método de seleção massal; método de seleção massal com autofecundação e testemunha (racemos de plantas colhidos ao acaso, sem seleção). Foram avaliados: porcentagem de flores femininas do racemo primário (%), produtividade de grãos (kg ha-1) e teor de óleo das sementes (%). O delineamento experimental utilizado foi o de blocos casualizados com 30 repetições. Os dados foram submetidos à análise de variância individual para cada local e conjuntamente para os dois locais, pelo teste F a 1% de probabilidade. Mediante os resultados conclui- se que o método de seleção massal com autofecundação foi aquele que proporcionou maiores valores de porcentagem de flores femininas no racemo primário, com ganho fenotípico realizado de 18% em Botucatu e 29% em São Manuel (SP). Por meio dos métodos de seleção, notou-se comportamento diferencial em relação aos locais para a característica produtividade de grãos, e o método seleção massal com autofecundação proporcionou a menor produtividade. No teor de óleo não houve diferenças significativas entre os métodos e os locais avaliados.

Net melon resistance to Didymella bryoniae according to grafting and potassium levels

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Teste de envelhecimento acelerado em sementes de aveia preta

Objetivou-se com este trabalho, estudar o teste de envelhecimento acelerado tradicional (com água), em sementes de aveia preta com e sem tratamento fungicida, e o envelhecimento acelerado com solução saturada de cloreto de sódio (NaCl), visando identificar o período de exposição e a temperatura para a classificação dos níveis de vigor de lotes dessas sementes. Foram utilizados cinco lotes de sementes, nos quais foram realizados testes para a caracterização da qualidade inicial de lotes (germinação, emergência de plântulas, condutividade elétrica, o comprimento de plântulas normais e massa de 1000 sementes), e estudado o envelhecimento acelerado tradicional (com água), com e sem tratamento fungicida, e o envelhecimento acelerado com solução saturada de sal (NaCl) por períodos de 24, 48, 72, 96 e 120 horas de condicionamento às temperaturas de 40, 43 e 45ºC. O teste de envelhecimento acelerado é adequado para estimar o vigor de sementes de aveia preta pelo procedimento tradicional (com e sem tratamento fungicida) ou com solução saturada de sal, ambos a temperatura de 40ºC por 24 horas.

Aplicação de microemulsões na solubilização de frações pesadas de petróleo

This work presents studies related to the use of microemulsions in the solubilization of heavy crude oil fractions responsible by the formation of deposits. The first stage of the work was addressed to the construction of phases diagrams, with the intention of determining the area within which the microemulsion is formed. The following systems were studied: UNITOL L 90 n-Butanol - Water - Kerosene (system 1); UNITOL L 90 - n-Butanol - Water - Xylene (system 2); UNITOL L 90 n-Butanol - Water - Kerosene/Xylene 10% (system 3); UNITOL L 90 - Sec-Butanol - Water - Xylene (system 4). In parallel experiments of physical adsorption were carried out by the static method, with the intention of simulating natural conditions of reservoirs. Crude oil of the Fazenda Belém field (Rio Grande do Norte), was used as solute, xylene as solvent and the Assu sandstone (Rio Grande do Norte, Brazil) and Botucatu sandstone (Paraná, Brazil) as rock reservoirs. The curves of adsorption presented the S format type, in agreement with the classification proposed by Giles, Smith and Huitson (1974). The solubilization process was accomplished in the batch method, by varying the time of agitation, the microemulsions and the solid/solution ratio. The experiments showed that the microemulsions presented high efficiency in the solubilization of the crude oil adsorbed on the sandstones. System 2 presented an efficiency of 99% for the Assu sandstone and 97% for the Botucatu sandstone

DNA extraction from hair shafts of wild Brazilian felids and canids

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Ensino de matemática pelo rádio (1950 1970): uma história falada e um documentário didático

This study aimed to describe and analyze aspects of the historical course of teaching Mathematics by Radio Experiences in Rio Grande do Norte, between the decades from 1950 to 1970 in order to organize a documentary (CD-ROM) containing information about Mathematics studied by Radio who have experienced it. In this, we use qualitative research. We seek support in the theoretical framework of cultural history and memory researchers as Certeau (1998), Chartier (1990), Le Goff (2008), Thompson (2002) and Peter Burke (2004). Moreover, we take the elements of oral history. We focus on the teaching of literacy and the primary of the Radio schools in two rural communities - Logradouro and Catolé - who are currently part of the city of Lagoa Salgada (RN) and, with respect to the Junior High School, we stopped in the Course of Madureza at Radio. We used as written sources, especially the documents found in the General Archives of the Archdiocese of Natal (RN) and the employees assigned by the participants of the survey. Our sources come from the oral testimonies of pupils and monitors Lagoa Salgada City, teachers, broadcasters and technicians of Rural Support Service (SAR) Natal (RN). In this study, we identify the geometry Cubação social practices of Lagoa Salgada students. Also identified in the research material, the Global Method with the pedagogy of Paulo Freire, that guided the production of lessons in literacy and primary courses. Content in Mathematics, we find traces of the trend-Empirical activist. In the course of Madureza, there was a tendency formal technique Fiorentini (1995). Finally, as a result of this study, organize and present a documentary (CD-ROM), along with the analysis of this study, containing the history of Mathematics teaching by Radio, from the speech of those who experienced Radio, emphasizing the methodology teaching developed in class, that serves as a reference material for students, professors and researchers.

Antimicrobial and Cytotoxic Activity of Fruit Extract from Syzygium cumini (L.) Skeels

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

LC Evaluation of Intestinal Transport of Praziquantel

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Caracterização magnética e estrutural de filmes depositados por gaiola catódica

Iron nitrite films, with hundred of nanometers thick, were deposited using the Cathodic cage plasma nitriding method, with a N2/H2 plasma, over a common glass substract. The structure, surface morphology and magnetic properties were investigated using X-ray diffractometry (XRD), atomic force microscopy (AFM) and vibrating sample magnetometer (VSM). XRD shows the formation of γ FeN phase and a combination of ζFe2N + ɛFe3N phases. The film s saturation magnetization and coercivity depends on morphology, composition, grain size and treatment temperature. Temperature raising from 250 ºC to 350 ºC were followed by an increase in saturation magnetization and film s surface coercivity on the parallel direction in relative proportion. This fact can be attributed to the grain sizes and to the different phases formed, since iron rich fases, like the ɛFe3N phase, emerges more frequently on more elevated treatment s temperature. Using this new and reasonably low cost method, it was possible to deposit films with both good adhesion and good magnetic properties, with wide application in magnetic devices

Structural phase transition study of FePt alloys using ab initio calculation

The FePt alloy undergoes the cubic to tetragonal lattice transformation in the ferromagnetic state. We calculated the electronic structure for both cubic and tetragonal structures using the FPLAPW method with APW + lo. Comparing the density of states of the cubic and tetragonal structures, it is expected that the lattice transformation is caused by the band Jahn-Teller effect. (C) 2009 Elsevier B.V. All rights reserved.