Genomic regions influencing seminal root traits in barley

Water availability is a major limiting factor for crop production, making drought adaptation and its many component traits a desirable attribute of plant cultivars. Previous studies in cereal crops indicate that root traits expressed at early plant developmental stages, such as seminal root angle and root number, are associated with water extraction at different depths. Here, we conducted the first study to map seminal root traits in barley (Hordeum vulgare L.). Using a recently developed high-throughput phenotyping method, a panel of 30 barley genotypes and a doubled-haploid (DH) population (ND24260 × 'Flagship') comprising 330 lines genotyped with diversity array technology (DArT) markers were evaluated for seminal root angle (deviation from vertical) and root number under controlled environmental conditions. A high degree of phenotypic variation was observed in the panel of 30 genotypes: 13.5 to 82.2 and 3.6 to 6.9° for root angle and root number, respectively. A similar range was observed in the DH population: 16.4 to 70.5 and 3.6 to 6.5° for root angle and number, respectively. Seven quantitative trait loci (QTL) for seminal root traits (root angle, two QTL; root number, five QTL) were detected in the DH population. A major QTL influencing both root angle and root number (RAQ2/RNQ4) was positioned on chromosome 5HL. Across-species analysis identified 10 common genes underlying root trait QTL in barley, wheat (Triticum aestivum L.), and sorghum [Sorghum bicolor (L.) Moench]. Here, we provide insight into seminal root phenotypes and provide a first look at the genetics controlling these traits in barley.

Molecular Breeding for Complex Adaptive Traits: How Integrating Crop Ecophysiology and Modelling Can Enhance Efficiency

Progress in crop improvement is limited by the ability to identify favourable combinations of genotypes (G) and management practices (M) in relevant target environments (E) given the resources available to search among the myriad of possible combinations. To underpin yield advance we require prediction of phenotype based on genotype. In plant breeding, traditional phenotypic selection methods have involved measuring phenotypic performance of large segregating populations in multi-environment trials and applying rigorous statistical procedures based on quantitative genetic theory to identify superior individuals. Recent developments in the ability to inexpensively and densely map/sequence genomes have facilitated a shift from the level of the individual (genotype) to the level of the genomic region. Molecular breeding strategies using genome wide prediction and genomic selection approaches have developed rapidly. However, their applicability to complex traits remains constrained by gene-gene and gene-environment interactions, which restrict the predictive power of associations of genomic regions with phenotypic responses. Here it is argued that crop ecophysiology and functional whole plant modelling can provide an effective link between molecular and organism scales and enhance molecular breeding by adding value to genetic prediction approaches. A physiological framework that facilitates dissection and modelling of complex traits can inform phenotyping methods for marker/gene detection and underpin prediction of likely phenotypic consequences of trait and genetic variation in target environments. This approach holds considerable promise for more effectively linking genotype to phenotype for complex adaptive traits. Specific examples focused on drought adaptation are presented to highlight the concepts.

The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1

While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1).

Sequence-dependent molecular conformation of polynucleotides: right and left-handed helices

Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.

Modified design procedure for a sparger reactor sequence

In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Molecular characterisation of the Vacuolating Autotransporter Toxin in Uropathogenic Escherichia coli

The vacuolating autotransporter (AT) toxin (Vat) contributes to Uropathogenic Escherichia coli (UPEC) fitness during systemic infection. Here we characterised Vat and investigated its regulation in UPEC. We assessed the prevalence of vat in a collection of 45 UPEC urosepsis strains and showed that it was present in 31 (68%) of the isolates. The isolates containing the vat gene corresponded to three major E. coli sequence types (ST12, 73 and 95) and these strains secreted the Vat protein. Further analysis of the vat genomic locus identified a conserved gene located directly downstream of vat that encodes a putative MarR-like transcriptional regulator, which we termed vatX. The vat-vatX genes were present in the UPEC reference strain CFT073 and RT-PCR revealed both genes are co-transcribed. Over-expression of vatX in CFT073 led to a 3-fold increase in vat gene transcription. The vat promoter region contained three putative nucleation sites for the global transcriptional regulator H-NS; thus the hns gene was mutated in CFT073 (to generate CFT073hns). Western blot analysis using a Vat-specific antibody revealed a significant increase in Vat expression in CFT073hns compared to wild-type CFT073. Direct H-NS binding to the vat promoter region was demonstrated using purified H-NS in combination with electrophoresis mobility shift assays. Finally, Vat-specific antibodies were detected in plasma samples from urosepsis patients infected by vat-containing UPEC strains, demonstrating Vat is expressed during infection. Overall, this study has demonstrated that Vat is a highly prevalent and tightly regulated immunogenic SPATE secreted by UPEC during infection.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Characterisation, cloning and production of industrially interesting enzymes: gluconolactone oxidase of Penicillium cyaneo-fulvum and gluconate 5-dehydrogenase of Gluconobacter suboxydans

The work covered in this thesis is focused on the development of technology for bioconversion of glucose into D-erythorbic acid (D-EA) and 5-ketogluconic acid (5-KGA). The task was to show on proof-of-concept level the functionality of the enzymatic conversion or one-step bioconversion of glucose to these acids. The feasibility of both studies to be further developed for production processes was also evaluated. The glucose - D-EA bioconversion study was based on the use of a cloned gene encoding a D-EA forming soluble flavoprotein, D-gluconolactone oxidase (GLO). GLO was purified from Penicillium cyaneo-fulvum and partially sequenced. The peptide sequences obtained were used to isolate a cDNA clone encoding the enzyme. The cloned gene (GenBank accession no. AY576053) is homologous to the other known eukaryotic lactone oxidases and also to some putative prokaryotic lactone oxidases. Analysis of the deduced protein sequence of GLO indicated the presence of a typical secretion signal sequence at the N-terminus of the enzyme. No other targeting/anchoring signals were found, suggesting that GLO is the first known lactone oxidase that is secreted rather than targeted to the membranes of the endoplasmic reticulum or mitochondria. Experimental evidence supports this analysis, as near complete secretion of GLO was observed in two different yeast expression systems. Highest expression levels of GLO were obtained using Pichia pastoris as an expression host. Recombinant GLO was characterised and the suitability of purified GLO for the production of D-EA was studied. Immobilised GLO was found to be rapidly inactivated during D-EA production. The feasibility of in vivo glucose - D-EA conversion using a P. pastoris strain co-expressing the genes of GLO and glucose oxidase (GOD, E.C. 1.1.3.4) of A. niger was demonstrated. The glucose - 5-KGA bioconversion study followed a similar strategy to that used in the D-EA production research. The rationale was based on the use of a cloned gene encoding a membrane-bound pyrroloquinoline quinone (PQQ)-dependent gluconate 5-dehydrogenase (GA 5-DH). GA 5-DH was purified to homogeneity from the only source of this enzyme known in literature, Gluconobacter suboxydans, and partially sequenced. Using the amino acid sequence information, the GA 5-DH gene was cloned from a genomic library of G. suboxydans. The cloned gene was sequenced (GenBank accession no. AJ577472) and found to be an operon of two adjacent genes encoding two subunits of GA 5-DH. It turned out that GA 5-DH is a rather close homologue of a sorbitol dehydrogenase from another G. suboxydans strain. It was also found that GA 5-DH has significant polyol dehydrogenase activity. The G. suboxydans GA 5-DH gene was poorly expressed in E. coli. Under optimised conditions maximum expression levels of GA 5-DH did not exceed the levels found in wild-type G. suboxydans. Attempts to increase expression levels resulted in repression of growth and extensive cell lysis. However, the expression levels were sufficient to demonstrate the possibility of bioconversion of glucose and gluconate into 5-KGA using recombinant strains of E. coli. An uncharacterised homologue of GA 5-DH was identified in Xanthomonas campestris using in silico screening. This enzyme encoded by chromosomal locus NP_636946 was found by a sequencing project of X. campestris and named as a hypothetical glucose dehydrogenase. The gene encoding this uncharacterised enzyme was cloned, expressed in E. coli and found to encode a gluconate/polyol dehydrogenase without glucose dehydrogenase activity. Moreover, the X. campestris GA 5-DH gene was expressed in E. coli at nearly 30 times higher levels than the G. suboxydans GA 5-DH gene. Good expressability of the X. campestris GA-5DH gene makes it a valuable tool not only for 5-KGA production in the tartaric acid (TA) bioprocess, but possibly also for other bioprocesses (e.g. oxidation of sorbitol into L-sorbose). In addition to glucose - 5-KGA bioconversion, a preliminary study of the feasibility of enzymatic conversion of 5-KGA into TA was carried out. Here, the efficacy of the first step of a prospective two-step conversion route including a transketolase and a dehydrogenase was confirmed. It was found that transketolase convert 5-KGA into TA semialdehyde. A candidate for the second step was suggested to be succinic dehydrogenase, but this was not tested. The analysis of the two subprojects indicated that bioconversion of glucose to TA using X. campestris GA 5-DH should be prioritised first and the process development efforts in future should be focused on development of more efficient GA 5-DH production strains by screening a more suitable production host and by protein engineering.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Phylogeography and Adaptive Divergence of Three-spined Stickleback Populations

Genetic studies on phylogeography and adaptive divergence in Northern Hemisphere fish species such as three-spined stickleback (Gasterosteus aculeatus) provide an excellent opportunity to investigate genetic mechanisms underlying population differentiation. According to the theory, the process of population differentiation results from a complex interplay between random and deterministic processes as well historical factors. The main scope in this thesis was to study how historical factors like the Pleistocene ice ages have shaped the patterns molecular diversity in three-spined stickleback populations in Europe and how this information could be utilized in the conservation genetic context. Furthermore, identifying footprints of natural selection at the DNA level might be used in identifying genes involved in evolutionary change. Overall, the results from phylogeographic studies indicate that the three-spined stickleback has colonized the Atlantic basin relatively recently but constitutes three major evolutionary lineages in Europe. In addition, the colonization of freshwater appears to result from multiple and independent invasions by the marine conspecifics. Molecular data together with morphology suggest that the most divergent freshwater populations are located in the Balkan Peninsula and these populations deserve a special conservation genetic status without warranting further taxonomical classification. In order to investigate the adaptive divergence in Fennoscandian three-spined stickleback populations several approaches were used. First, sequence variability in the Eda-gene, coding for the number of lateral plates, was concordant with the previously observed global pattern. Full plated allele is in high frequencies among marine populations whereas low plated allele dominates in the freshwater populations. Second, a microsatellite based genome scan identified both indications of balancing and directional selection in the three-spined stickleback genome, i.e. loci with unusually similar or unusually different allele frequencies over populations. The directionally selected loci were mainly associated with the adaptation to freshwater. A follow up study conducting a more detailed analysis in a chromosome region containing a putatively selected gene locus identified a fairly large genomic region affected by natural selection. However, this region contained several gene predictions, all of which might be the actual target of natural selection. All in all, the phylogeographic and adaptive divergence studies indicate that most of the genetic divergence has occurred in the freshwater populations whereas the marine populations have remained relatively uniform.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.