The Effects of Crushed Particles in Asphalt Mixtures, HR-311 and MLR-88-16, 1990

One of the most serious impediments to the continued successful use of hot-mix asphalt (HMA) pavements is rutting. The Iowa Department of Transportation has required 85% crushed particles and 75-blow Marshall mix design in an effort to prevent rutting on Interstate roadways. Relationships between the percent of crushed particles and resistance to rutting in pavement through the use of various laboratory test procedures must be developed. HMA mixtures were made with 0, 30, 60, 85, and 100% crushed gravel, crushed limestone, and crushed quartzite combined with uncrushed sand and gravel. These aggregate combinations were used with 4, 5, and 6% asphalt cement (ac). Laboratory tests included Marshall stability, resilient modulus, indirect tensile, and creep. A creep resistance factor (CRF) was developed to provide a single numeric value for creep test results. The CRF values relate well to the amount of crushed particles and the perceived resistance to rutting. The indirect tensile test is highly dependent on the ac with a small effect from the percent of crushed particles. The Marshall stability from 75-blow compaction relates well to the percent of crushed particles. The resilient modulus in some cases is highly affected by grade of ac.

The Bacillus subtilis bacteriophage SPP1 G39P delivers and activates the G40P DNA helicase upon interacting with the G38P-bound replication origin.

Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.

Phylogeography and Pleistocene refugia of the adder (Vipera berus) as inferred from mitochondrial DNA sequence data.

In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Sodium reduction in cooked meat products by using commercial potassium phoshate mixtures

Selostus: Natriumpitoisuuden pienentäminen lihavalmisteissa korvaamalla natriumfosfaatti kaliumfosfaatilla

Evaluation Study of Pit Run Gravel Asphalt Treated Base Mixtures with Various Percentages of Crushed Limestone, R-217, 1968

In November of 1966, an investigation of the rigid Class I asphalt treated base specification, requiring 70 per cent crushed limestone, was initiated. It was felt that it might be possible to modify the need for crushed particles, in the construction of basis on heavy duty roads, at a savings, by using more local materials, without sacrificing strength and/or durability. This is a short study on typical sources of pit run gravel, with various percentages of limestone. It is conducted with an eye open to the possibility that our specifications may be modified. The possibility that further investigation may be desirable is not ignored.

Evaluation of Cohesion and Swell Characteristics of Asphalt Treated Base Mixtures, R-223, 1968

This study was undertaken to evaluate the suitability of various stones which play an important role in the properties of compacted mixtures in asphalt treated bases. The determination of the effect of water temperature on the cohesion of the mixes is investigated. A number of stones were prepared for the test. Attention is paid to the particular source of stone with the corresponding test results. A preliminary study of the effect of lime when added to mixed aggregate was also conducted. The purpose of this study is to provide needed information on the cohesive characteristics of asphalt treated bases using a wide range of stones. This study is also to evaluate the suitability of the various stone sources.

Time-Temperature Strength-Reaction Product Relationships in Lime-Bentonite-Water Mixtures, HR-111, 1965

The interrelation of curing time, curing temperature, strength, and reactions in lime-bentonite-water mixtures was examined. Samples were molded at constant density and moisture content and then cured for periods of from 1 to 56 days at constant temperatures that ranged from 5C to 60C. After the appropriate curing time the samples were tested for unconfined compressive strength. The broken samples were then analyzed by x-ray diffractometer and spectrophotometer to determine the identity of the reaction products present after each curing period. It was found that the strength gain of lime-clay mixtures cured at different temperatures is due to different phases of the complex reaction, lime & clay to CSH(gel) to CSH(II) to CSH(I) to tobermorite. The farther the reaction proceeds, the higher the strength. There was also evidence of lattice substitutions in the structure of the calcium silicate hydrates at curing temperatures of 50C and higher. No consistent relationship between time, temperature, strength, and the S/A ration of reaction products existed, but in order to achieve high strengths the apparent C/S ration had to be less than two. The curing temperature had an effect on the strength developed by a given amount of reacted silica in the cured lime-clay mixture, but at a given curing temperature the cured sample that had the largest amount of reacted silica gave the highest strength. Evidence was found to indicate that during the clay reaction some calcium is indeed adsorbed onto the clay structure rather than entering into a pozzolanic reaction. Finally, it was determined that it is possible to determine the amount of silica and alumina in lime-clay reaction products by spectrophotometric analysis with sufficient accuracy for comparison purposes. The spectrophotometric analysis techniques used during the investigation were simple and were not time consuming.

DNA ja koulukirjat vielä kerran

Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.

Siihen aikaan kun DNA lukion biologian kirjoihin tuli

Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004

Absorptive Aggregates in Asphalt Paving Mixtures, HR-142, 1971

In this study, the asphalt absorption of six Iowa limestones were investigated. It was found that the most important factors that determined the nature, amount, and rate of asphalt absorption are porosity and pore-size distribution of the aggregate, viscosity of the asphalt, and time. Methods needed to determine the realistic maximum and minimum asphalt absorption by aggregates are recommended. Simple methods of asphalt absorption were developed. Since the most important factor that determines the accuracy of asphalt absorption is the bulk specific gravity of aggregates and since the current ASTM method is not adequate in this respect, several new methods were developed. Preliminary treatment studies for the purpose of upgrading absorptive aggregates were conducted using close to 40 chemicals. The improvements of some of these treatments on the mixture properties were demonstrated.

Determination of Asphalt Content and Characteristics of Bituminous Paving Mixtures, MLR-88-11, 1988

Due to the hazardous nature of chemical asphalt extraction agents, nuclear gauges have become an increasingly popular method of determining the asphalt content of a bituminous mix. This report details the results of comparisons made between intended, tank stick, extracted, and nuclear asphalt content determinations. A total of 315 sets of comparisons were made on samples that represented 110 individual mix designs and 99 paving projects. All samples were taken from 1987 construction projects. In addition to the comparisons made, seventeen asphalt cement samples were recovered for determination of penetration and viscosity. Results were compared to similar tests performed on the asphalt assurance samples in an attempt to determine the amount of asphalt hardening that can be expected due to the hot mix process. Conclusions of the report are: 1. Compared to the reflux extraction procedure, nuclear asphalt content gauges determine asphalt content of bituminous mixes with much greater accuracy and comparable precision. 2. As a means for determining asphalt content, the nuclear procedure should be used as an alternate to chemical extractions whenever possible. 3. Based on penetration and viscosity results, softer grade asphalts undergo a greater degree 'of hardening due to hot mix processing than do harder grades, and asphalt viscosity changes caused by the mixing process are subject to much more variability than are changes in penetration. 4. Based on changes in penetration and viscosity, the Thin Film Oven Test provides a reasonable means of estimating how much asphalt hardening can be anticipated due to exposure to the hot mix processing environment.

DNA ja Helsingin geneetikot

Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin

Validation of real-time methylation-specific PCR to determine O6-methylguanine-DNA methyltransferase gene promoter methylation in glioma.

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.

Current directions in DNA gel particles

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.