Theoretical and experimental investigations on homologation of ethanol to butanol using a ruthenium-based catalyst

The mechanism of homologation of bioethanol to butanol and higher alcohols via the Guerbet reaction was computationally and experimentally investigated. The catalytic pathway involves a ruthenium-based complex and a base co-catalyst which work simultaneously. Due to selectivity issues, secondary products were formed and high competition between main pathway and side reactions was recorded. Herein, the overall catalytic mechanism for all the processes involved in was investigated, also considering the principal side reactions, using density functional theory (DFT) methods and experiments to confirm theoretical outcomes. Due to the complexity of the reaction network, kinetic simulations were established from DFT results, confirming experimental products distribution and giving insights into the factors governing the reaction mechanism.

Comprehensive characterization of snowfall in terms of microphysical features, quantitative precipitation estimation and scavenging properties by in situ and remote sensing observations at an Antarctic coastal site

Snow plays a crucial role in the Earth's hydrological cycle and energy budget, making its monitoring necessary. In this context, ground-based radars and in situ instruments are essential thanks to their spatial coverage, resolution, and temporal sampling. Deep understanding and reliable measurements of snow properties are crucial over Antarctica to assess potential future changes of the surface mass balance (SMB) and define the contribution of the Antarctic ice sheet on sea-level rise. However, despite its key role, Antarctic precipitation is poorly investigated due to the continent's inaccessibility and extreme environment. In this framework, this Thesis aims to contribute to filling this gap by in-depth characterization of Antarctic precipitation at the Mario Zucchelli station from different points of view: microphysical features, quantitative precipitation estimation (QPE), vertical structure of precipitation, and scavenging properties. For this purpose, a K-band vertically pointing radar collocated with a laser disdrometer and an optical particle counter (OPC) were used. The radar probed the lowest atmospheric layers with high vertical resolution, allowing the first trusted measurement at only 105 m height. Disdrometer and OPC provided information on the particle size distribution and aerosol concentrations. An innovative snow classification methodology was designed by comparing the radar reflectivity (Ze) and disdrometer-derived reflectivity by means of DDA simulations. Results of classification were exploited in QPE through appropriate Ze-snow rate relationships. The accuracy of the resulting QPE was benchmarked against a collocated weighing gauge. Vertical radar profiles were also investigated to highlight hydrometeors' sublimation and growth processes. Finally, OPC and disdrometer data allowed providing the first-ever estimates of scavenging properties of Antarctic snowfall. Results presented in this Thesis give rise to advances in knowledge of the characteristics of snowfall in Antarctica, contributing to a better assessment of the SMB of the Antarctic ice sheet, the major player in the global sea-level rise.

Collective actions for environmental monitoring and conservation: citizen science, informal environmental education, and participatory approach

This PhD was driven by an interest for inclusive and participatory approaches. The methodology that bridges science and society is known as 'citizen science' and is experiencing a huge upsurge worldwide, in the scientific and humanities fields. In this thesis, I have focused on three topics: i) assessing the reliability of data collected by volunteers; ii) evaluating the impact of environmental education activities in tourist facilities; and iii) monitoring marine biodiversity through citizen science. In addition to these topics, during my research stay abroad, I developed a questionnaire to investigate people's perceptions of natural areas to promote the implementation of co-management. The results showed that volunteers are not only able to collect sufficiently reliable data, but that during their participation in this type of project, they can also increase their knowledge of marine biology and ecology and their awareness of the impact of human behaviour on the environment. The short-term analysis has shown that volunteers are able to retain what they have learned. In the long term, knowledge is usually forgotten, but awareness is retained. Increased awareness could lead to a change in behaviour and in this case a more environmentally friendly attitude. This aspect could be of interest for the development of environmental education projects in tourism facilities to reduce the impact of tourism on the environment while adding a valuable service to the tourism offer. We also found that nature experiences in childhood are important to connect to nature in adulthood. The results also suggest that membership or volunteering in an environmental education association could be a predictor of people's interest in more participatory approaches to nature management. In most cases, the COVID -19 pandemic had not changed participants' perceptions of the natural environment.

PCM-based battery thermal management systems, energy saving materials and LCA strategy for automotive

This PhD work arises from the necessity to give a contribution to the energy saving field, regarding automotive applications. The aim was to produce a multidisciplinary work to show how much important is to consider different aspects of an electric car realization: from innovative materials to cutting-edge battery thermal management systems (BTMSs), also dealing with the life cycle assessment (LCA) of the battery packs (BPs). Regarding the materials, it has been chosen to focus on carbon fiber composites as their use allows realizing light products with great mechanical properties. Processes and methods to produce carbon fiber goods have been analysed with a special attention on the university solar car Emilia 4. The work proceeds dealing with the common BTMSs on the market (air-cooled, cooling plates, heat pipes) and then it deepens some of the most innovative systems such as the PCM-based BTMSs after a previous experimental campaign to characterize the PCMs. After that, a complex experimental campaign regarding the PCM-based BTMSs has been carried on, considering both uninsulated and insulated systems. About the first category the tested systems have been pure PCM-based and copper-foam-loaded-PCM-based BTMSs; the insulated tested systems have been pure PCM-based and copper-foam-loaded-PCM-based BTMSs and both of these systems equipped with a liquid cooling circuit. The choice of lighter building materials and the optimization of the BTMS are strategies which helps in reducing the energy consumption, considering both the energy required by the car to move and the BP state of health (SOH). Focusing on this last factor, a clear explanation regarding the importance of taking care about the SOH is given by the analysis of a BP production energy consumption. This is why a final dissertation about the life cycle assessment (LCA) of a BP unit has been presented in this thesis.

Advanced statistical models for the segregation, identification and measurement of coexisting sound sources

Long-term monitoring of acoustical environments is gaining popularity thanks to the relevant amount of scientific and engineering insights that it provides. The increasing interest is due to the constant growth of storage capacity and computational power to process large amounts of data. In this perspective, machine learning (ML) provides a broad family of data-driven statistical techniques to deal with large databases. Nowadays, the conventional praxis of sound level meter measurements limits the global description of a sound scene to an energetic point of view. The equivalent continuous level Leq represents the main metric to define an acoustic environment, indeed. Finer analyses involve the use of statistical levels. However, acoustic percentiles are based on temporal assumptions, which are not always reliable. A statistical approach, based on the study of the occurrences of sound pressure levels, would bring a different perspective to the analysis of long-term monitoring. Depicting a sound scene through the most probable sound pressure level, rather than portions of energy, brought more specific information about the activity carried out during the measurements. The statistical mode of the occurrences can capture typical behaviors of specific kinds of sound sources. The present work aims to propose an ML-based method to identify, separate and measure coexisting sound sources in real-world scenarios. It is based on long-term monitoring and is addressed to acousticians focused on the analysis of environmental noise in manifold contexts. The presented method is based on clustering analysis. Two algorithms, Gaussian Mixture Model and K-means clustering, represent the main core of a process to investigate different active spaces monitored through sound level meters. The procedure has been applied in two different contexts: university lecture halls and offices. The proposed method shows robust and reliable results in describing the acoustic scenario and it could represent an important analytical tool for acousticians.

Massive MIMO-based system analysis and comparison with MIMO based-systems

The thesis is focused on introducing basic MIMO-based and Massive MIMO-based systems and their possible benefits. Then going through the implementation options that we have, according to 3GPP standards, for 5G systems and how the transition is done from a non-standalone 5G RAN to a completely standalone 5G RAN. Having introduced the above-mentioned subjects and providing some definition of telecommunications principles, we move forward to a more technical analysis of the Capacity, Throughput, Power consumption, and Costs. Comparing all the mentioned parameters between a Massive-MIMO-based system and a MIMO-based system. In the analysis of power consumption and costs, we also introduce the concept of virtualization and its benefits in terms of both power and costs. Finally, we try to justify a trade-off between having a more reliable system with a high capacity and throughput while keeping the costs as low as possible.

Delays In Receiving Obstetric Care And Poor Maternal Outcomes: Results From A National Multicentre Cross-sectional Study.

The vast majority of maternal deaths in low-and middle-income countries are preventable. Delay in obtaining access to appropriate health care is a fairly common problem which can be improved. The objective of this study was to explore the association between delay in providing obstetric health care and severe maternal morbidity/death. This was a multicentre cross-sectional study, involving 27 referral obstetric facilities in all Brazilian regions between 2009 and 2010. All women admitted to the hospital with a pregnancy-related cause were screened, searching for potentially life-threatening conditions (PLTC), maternal death (MD) and maternal near-miss (MNM) cases, according to the WHO criteria. Data on delays were collected by medical chart review and interview with the medical staff. The prevalence of the three different types of delays was estimated according to the level of care and outcome of the complication. For factors associated with any delay, the PR and 95%CI controlled for cluster design were estimated. A total of 82,144 live births were screened, with 9,555 PLTC, MNM or MD cases prospectively identified. Overall, any type of delay was observed in 53.8% of cases; delay related to user factors was observed in 10.2%, 34.6% of delays were related to health service accessibility and 25.7% were related to quality of medical care. The occurrence of any delay was associated with increasing severity of maternal outcome: 52% in PLTC, 68.4% in MNM and 84.1% in MD. Although this was not a population-based study and the results could not be generalized, there was a very clear and significant association between frequency of delay and severity of outcome, suggesting that timely and proper management are related to survival.

Antimicrobial And Antiproliferative Potential Of Anadenanthera Colubrina (vell.) Brenan.

The aim of the present study was to perform an in vitro analysis of the antimicrobial and antiproliferative potential of an extract from Anadenanthera colubrina (Vell.) Brenan (angico) and chemically characterize the crude extract. Antimicrobial action was evaluated based on the minimum inhibitory concentration (MIC), minimum bactericidal/fungicidal concentration, and the inhibition of formation to oral biofilm. Cell morphology was determined through scanning electron microscopy (SEM). Six strains of tumor cells were used for the determination of antiproliferative potential. The extract demonstrated strong antifungal activity against Candida albicans ATCC 18804 (MIC = 0.031 mg/mL), with similar activity found regarding the ethyl acetate fraction. The extract and active fraction also demonstrated the capacity to inhibit the formation of Candida albicans to oral biofilm after 48 hours, with median values equal to or greater than the control group, but the difference did not achieve statistical significance (P > 0.05). SEM revealed alterations in the cell morphology of the yeast. Regarding antiproliferative activity, the extract demonstrated cytostatic potential in all strains tested. The present findings suggest strong antifungal potential for Anadenanthera colubrina (Vell.) Brenan as well as a tendency toward diminishing the growth of human tumor cells.

Jnk And Ikkβ Phosphorylation Is Reduced By Glucocorticoids In Adipose Tissue From Insulin-resistant Rats.

Peripheral insulin resistance (IR) is one of the main side effects caused by glucocorticoid (GC)-based therapies, and the molecular mechanisms of GC-induced IR are not yet fully elucidated. Thus, we aimed to investigate the effects of dexamethasone treatment on the main components of insulin and inflammatory signaling in the adipose tissue of rats. Male Wistar rats received daily injections of dexamethasone (1mg/kg body weight (b.w.), intraperitoneally (i.p.)) for 5 days (DEX), whereas control rats received saline (CTL). The metabolic status was investigated, and the epididymal fat fragments were collected for lipolysis and western blot analyses. The DEX rats became hyperglycemic, hyperinsulinemic, insulin resistant and glucose intolerant, compared with the CTL rats (P<0.05). The basal glycerol release in the fat fragments was 1.5-fold higher in the DEX rats (P<0.05). The phosphorylation of protein kinase B (PKB) at ser(473) decreased by 44%, whereas, the phosphorylation of insulin receptor substrate (IRS)-1 at ser(307) increased by 93% in the adipose tissue of the DEX rats after an oral bolus of glucose (P<0.05). The basal phosphorylation of c-jun-N-terminal kinase (JNK) and inhibitor of nuclear factor kappa-B (IKKβ) proteins was reduced by 46% and 58%, respectively, in the adipose tissue of the DEX rats (P<0.05). This was paralleled with a significant reduction (47%) in the glucocorticoid receptor (GR) protein content in the adipose tissue of the DEX rats (P<0.05). The insulin-resistant status of rats induced by dexamethasone administration have PKB and IRS-1 activity attenuated in epididymal fat without increases in the phosphorylation of the proinflammatory signals JNK and IKKβ.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Bond strength of a pit-and-fissure sealant associated to etch-and-rinse and self-etching adhesive systems to saliva-contaminated enamel: individual vs. simultaneous light curing

This study evaluated in vitro the shear bond strength (SBS) of a resin-based pit-and-fissure sealant [Fluroshield (F), Dentsply/Caulk] associated with either an etch-and-rinse [Adper Single Bond 2 (SB), 3M/ESPE] or a self-etching adhesive system [Clearfil S3 Bond (S3), Kuraray Co., Ltd.] to saliva-contaminated enamel, comparing two curing protocols: individual light curing of the adhesive system and the sealant or simultaneous curing of both materials. Mesial and distal enamel surfaces from 45 sound third molars were randomly assigned to 6 groups (n=15), according to the bonding technique: I - F was applied to 37% phosphoric acid etched enamel. The other groups were contaminated with fresh human saliva (0.01 mL; 10 s) after acid etching: II - SB and F were light cured separately; III - SB and F were light cured together; IV - S3 and F were light cured separately; V - S3 and F were light cured simultaneously; VI - F was applied to saliva-contaminated, acid-etched enamel without an intermediate bonding agent layer. SBS was tested to failure in a universal testing machine at 0.5 mm/min. Data were analyzed by one-way ANOVA and Fisher's test (α=0.05).The debonded specimens were examined with a stereomicroscope to assess the failure modes. Three representative specimens from each group were observed under scanning electron microscopy for a qualitative analysis. Mean SBS in MPa were: I-12.28 (±4.29); II-8.57 (±3.19); III-7.97 (±2.16); IV-12.56 (±3.11); V-11.45 (±3.77); and VI-7.47 (±1.99). In conclusion, individual or simultaneous curing of the intermediate bonding agent layer and the resin sealant did not seem to affect bond strength to saliva-contaminated enamel. S3/F presented significantly higher SBS than the that of the groups treated with SB etch-and-rinse adhesive system and similar SBS to that of the control group, in which the sealant was applied under ideal dry, noncontaminated conditions.

Spatial analysis of urban violence based on emergency room data

OBJECTIVE: To estimate the spatial intensity of urban violence events using wavelet-based methods and emergency room data. METHODS: Information on victims attended at the emergency room of a public hospital in the city of São Paulo, Southeastern Brazil, from January 1, 2002 to January 11, 2003 were obtained from hospital records. The spatial distribution of 3,540 events was recorded and a uniform random procedure was used to allocate records with incomplete addresses. Point processes and wavelet analysis technique were used to estimate the spatial intensity, defined as the expected number of events by unit area. RESULTS: Of all georeferenced points, 59% were accidents and 40% were assaults. There is a non-homogeneous spatial distribution of the events with high concentration in two districts and three large avenues in the southern area of the city of São Paulo. CONCLUSIONS: Hospital records combined with methodological tools to estimate intensity of events are useful to study urban violence. The wavelet analysis is useful in the computation of the expected number of events and their respective confidence bands for any sub-region and, consequently, in the specification of risk estimates that could be used in decision-making processes for public policies.

Survival, population pize, and gonotrophic cycle duration of Nyssomyia neivai (Diptera: Psychodidae) at an endemic area of American Cutaneous Leishmaniasis in Southeastern Brazil

The survival, absolute population size, gonotrophic cycle duration, and temporal and spatial abundance of Nyssomyia neivai (Pinto) were studied in a rural area endemic for American cutaneous leishmaniasis (ACL) in Conchal, Sõo Paulo State, southeastern Brazil, using mark-release-recapture techniques and by monitoring population fluctuation. The monthly abundance exhibited a unimodal pattern, with forest and domicile habitats having the highest relative abundances. A total of 1,873 males and 3,557 females were marked and released during the six experiments, of which 4.1-13.0 per cent of males and 4.1-11.8 per cent of females were recaptured. Daily survivorship estimated from the decline in recaptures per day was 0.681 for males and 0.667 for females. Gonotrophic cycle duration was estimated to be 4.0 d. Absolute population size was calculated using the Lincoln Index and ranged from 861 to 4,612 males and from 2,187 to 19,739 females. The low proportion of females that reach the age when they are potentially infective suggests that N. neivai has a low biological capacity to serve as a vector and that factors such as high biting rates and opportunistic feeding behavior would be needed to enable Leishmania (Viannia) braziliensis Vianna transmission. This agreed with the epidemiological pattern of ACL in southeastern Brazil that is characterized by low incidence, with isolated cases acquired principally within domiciliary habitats

Assessment of the Mutagenic Activity of Extracts of Brazilian Propolis in Topical Pharmaceutical Formulations on Mammalian Cells In Vitro and In Vivo

Propolis possesses various biological activities such as antibacterial, antifungal, anti-inflammatory, anesthetic and antioxidant properties. A topically applied product based on Brazilian green propolis was developed for the treatment of burns. For such substance to be used more safely in future clinical applications, the present study evaluated the mutagenic potential of topical formulations supplemented with green propolis extract (1.2, 2.4 and 3.6%) based on the analysis of chromosomal aberrations and of micronuclei. In the in vitro studies, 3-h pulse (G(1) phase of the cell cycle) and continuous (20 h) treatments were performed. In the in vivo assessment, the animals were injured on the back and then submitted to acute (24 h), subacute (7 days) and subchronic (30 days) treatments consisting of daily dermal applications of gels containing different concentrations of propolis. Similar frequencies of chromosomal aberrations were observed for cultures submitted to 3-h pulse and continuous treatment with gels containing different propolis concentrations and cultures not submitted to any treatment. However, in the continuous treatment cultures treated with the 3.6% propolis gel presented significantly lower mitotic indices than the negative control. No statistically significant differences in the frequencies of micronuclei were observed between animals treated with gels containing different concentrations of propolis and the negative control for the three treatment times. Under the present conditions, topical formulations containing different concentrations of green propolis used for the treatment of burns showed no mutagenic effect in either test system, but 3.6% propolis gel was found to be cytotoxic in the in vitro test.

Alstonine as an Antipsychotic: Effects on Brain Amines and Metabolic Changes

Managing schizophrenia has never been a trivial matter. Furthermore, while classical antipsychotics induce extrapyramidal side effects and hyperprolactinaemia, atypical antipsychotics lead to diabetes, hyperlipidaemia, and weight gain. Moreover, even with newer drugs, a sizable proportion of patients do not show significant improvement. Alstonine is an indole alkaloid identified as the major component of a plant-based remedy used in Nigeria to treat the mentally ill. Alstonine presents a clear antipsychotic profile in rodents, apparently with differential effects in distinct dopaminergic pathways. The aim of this study was to complement the antipsychotic profile of alstonine, verifying its effects on brain amines in mouse frontal cortex and striatum. Additionally, we examined if alstonine induces some hormonal and metabolic changes common to antipsychotics. HPLC data reveal that alstonine increases serotonergic transmission and increases intraneuronal dopamine catabolism. In relation to possible side effects, preliminary data suggest that alstonine does not affect prolactin levels, does not induce gains in body weight, but prevents the expected fasting-induced decrease in glucose levels. Overall, this study reinforces the proposal that alstonine is a potential innovative antipsychotic, and that a comprehensive understanding of its neurochemical basis may open new avenues to developing newer antipsychotic medications.