Pile Design and Tests for Integral Abutment Bridges, HR-273, 1987

Expansion joints increase both the initial cost and the maintenance cost of bridges. Integral abutment bridges provide an attractive design alternative because expansion joints are eliminated from the bridge itself. However, the piles in these bridges are subjected to horizontal movement as the bridge expands and contracts during temperature changes. The objective of this research was to develop a method of designing piles for these conditions. Separate field tests simulating a pile and a bridge girder were conducted for three loading cases: (1) vertical load only, (2) horizontal displacement of pile head only, and (3) combined horizontal displacement of pile head with subsequent vertical load. Both tests (1) and (3) reached the same ultimate vertical load, that is, the horizontal displacement had no effect on the vertical load capacity. Several model tests were conducted in sand with a scale factor of about 1:10. Experimental results from both the field and model tests were used to develop the vertical and horizontal load-displacement properties of the soil. These properties were input into the finite element computer program Integral Abutment Bridge Two-Dimensional (IAB2D), which was developed under a previous research contract. Experimental and analytical results compared well for the test cases. Two alternative design methods, both based upon the American Association of State Highway and Transportation Officials (AASHTO) Specification, were developed. Alternative One is quite conservative relative to IAB2D results and does not permit plastic redistribution of forces. Alternative Two is also conservative when compared to IAB2D, but plastic redistribution is permitted. To use Alternative Two, the pile cross section must have sufficient inelastic rotation capacity before local buckling occurs. A design example for a friction pile and an end-bearing pile illustrates both alternatives.

Development of blast resistant somaclones of the upland rice cultivar araguaia

The degree of blast resistance of upland rice (Oryza sativa L.) cultivar Araguaia has decreased over time causing significant yield losses. The major objective of this study was to obtain blast (Pyricularia grisea) resistant somaclones, adapting greenhouse and field selection procedures. Rice blast resistance and agronomic traits were assessed in R2 to R6 generations derived from regenerant plants (R1) from immature panicles of Araguaia. The evaluation and selection procedures include testing of early segregating populations and fixed lines in the advanced generations, under natural field conditions, and artificial inoculations in the greenhouse, with prevalent races IB-1 and IB-9 of P. grisea. Somaclones with both vertical resistance and slow blasting resistance were obtained. Twenty of 31 somaclones developed with a high degree of vertical resistance and fan shaped plant type maintained resistance in field and blast nursery tests in the R6 generation. Greenhouse selection with two specific physiologic races yielded 44 somaclones with slow blasting resistance, similar plant type and yield potential as that of Araguaia.

Lag-one autocorrelation in short series: Estimation and hypothesis testing

In the first part of the study, nine estimators of the first-order autoregressive parameter are reviewed and a new estimator is proposed. The relationships and discrepancies between the estimators are discussed in order to achieve a clear differentiation. In the second part of the study, the precision in the estimation of autocorrelation is studied. The performance of the ten lag-one autocorrelation estimators is compared in terms of Mean Square Error (combining bias and variance) using data series generated by Monte Carlo simulation. The results show that there is not a single optimal estimator for all conditions, suggesting that the estimator ought to be chosen according to sample size and to the information available of the possible direction of the serial dependence. Additionally, the probability of labelling an actually existing autocorrelation as statistically significant is explored using Monte Carlo sampling. The power estimates obtained are quite similar among the tests associated with the different estimators. These estimates evidence the small probability of detecting autocorrelation in series with less than 20 measurement times.

Incorporation and washout of n-3 PUFA after high dose intravenous and oral supplementation in healthy volunteers.

BACKGROUND & AIMS: Although the physiological effects of n-3 polyunsaturated fatty acids (n-3PUFA) are generally thought to require several weeks of exposure to allow their incorporation into plasma membranes, intravenous (IV) n-3PUFA attenuate the cardiovascular and neuroendocrine response to stress within 3 h. Whether oral n-3 PUFA exert similar early effects remains unknown. OBJECTIVE: To assess whether acute IV or short term oral n-3PUFA administration reproduces the metabolic effects of long term oral supplements during exercise, and how it relates to their incorporation into platelets and red blood cells (RBC) membranes. DESIGN: Prospective single center open label study in 8 healthy subjects receiving a 3-h infusion of 0.6 g/kg body weight n-3PUFA emulsion, followed one week later by an oral administration of 0.6 g/kg over 3 consecutive days. Maximal power output (cycling exercise), maximal heart rate (HR), blood lactate at exhaustion, and platelet function were measured at baseline and after IV or 3-day oral supplementation; platelet and RBC membrane composition were assessed until 15 days after n-3PUFA administration. RESULTS: Both IV and oral n-3PUFA significantly decreased maximal HR (-6% and -5%), maximal power output (-10%) and peak blood lactate (-47% and -52%) Platelet function tests were unchanged. The EPA and DHA membrane contents of RBC and platelets increased significantly, but only to 1.7-1.9% of fatty acid content. CONCLUSION: The cardiovascular and metabolic effects of n-3 PUFA during exercise occur already within 1-3 days of exposure, and may be unrelated to changes in membranes composition. Effects occur within hours of administration and are unrelated to lipid membrane composition. Trial registered at clinicaltrials.gov as NCT00516178.

Long-term and long range migration of radioisotopes in terrestrial systems : mechanisms of radioisotopes (Cs, Sr, Pu, Am) mobilization in soils

Summary Artificial radionuclides were released in the environment during the atmospheric nuclear weapon tests and after accidental events involving nuclear industries. As a primary receptor of the deposition, the soil is a very sensitive compartment and understanding the interaction and migration of radionuclides within soils allows the development of scenario for the contamination risk of the population and of the environment. Most available field studies on radionuclides in soils only concern one or two isotopes, mostly 137Cs, and few physico-chemical soil parameters. The purpose of this study was a broader understanding of the radioecology of an Alpine valley. In a first part, we aimed to describe the depth distribution of 137Cs, 90Sr, 239+240Pu, and 241Am within different alpine soils and to identify some stable elements as indicators for accumulating layers. In the central part of the study, the goal was to investigate the repartition of ^Sr and 239Pu between the truly dissolved fraction and the colloidal fraction of the soil solutions and to identify the nature of colloids involved in the adsorption of ^Sr and 239Pu. These results were integrated in an "advection- sorption" transport model seeking to explain the migration of 239Pu and 90Sr within the soils and to assess the importance of colloidal transport for these two isotopes. A further aspect studied was the role of the competition between the radioisotopes (137Cs and 90Sr) and their stable chemical analogues (K and Ca) with respect to plant uptake by different plant species. The results on the depth distribution within the soils showed that 137Cs was mostly retained in the topsoil, to the exception of an organic-rich soil (Histosol 2) receiving important surface runoff, where migration down to a depth of 30 cm was observed. 137Cs depth distribution within the soils was similar to unsupported 210Pb depth distribution. The plant uptake of 137Cs clearly depended on the concentration of exchangeable potassium in the soils. Moreover, we showed that the 137Cs uptake by certain species of the taxonomic orders Poales and Rosales was more sensitive to the increase in exchangeable Κ compared to other orders. Strontium-90 was much more mobile in the soils than 137Cs and depth migration and accumulation in specific AI- and Fe-rich layers were found down to 30 cm. Copper and Ni showed accumulations in these same layers, indicating their potential to be used as indicators for the migration of ^Sr within the soils. In addition, we observed a 90Sr activity peak in the topsoil that can be attributable to recycling of 90Sr by plant uptake. We demonstrated for the first time that a part of 90Sr (at least 40%) was associated with the colloids in organic-rich soil solutions. Therefore, we predict a significant effect of the colloidal migration of ^Sr in organic-rich soil solutions. The plant uptake results for 90Sr indicated a phylogenetic effect between Non-Eudicot and Eudicots: the order Poales concentrating much less 90Sr than Eudicots do. Moreover, we were able to demonstrate that the sensitivity of the 90Sr uptake by 5 different Alpine plant species to the amount of exchangeable Ca was species-independent. Plutonium and 241Am accumulated in the second layer of all soils and only a slight migration deeper than 20 cm was observed. Plutonium and 241Am showed a similar depth distribution in the soils. The model results suggested that the present day migration of 239Pu was very slow and that the uptake by plants was negligible. 239Pu activities between 0.01 to 0.08 mBq/L were measured in the bulk soil solutions. Migration of 239Pu with the soil solution is dominated by colloidal transport. We reported strong evidences that humic substances were responsible of the sorption of 239Pu to the colloidal fraction of the soil solutions. This was reflected by the strong correlation between 239Pu concentrations and the content of (colloidal) organic matter in the soil solution. Résumé Certains radioéléments artificiels ont été disséminés dans l'environnement suite aux essais atmosphériques de bombes nucléaires et suite à des accidents impliquant les industries nucléaires. En tant que récepteur primaire de la déposition, le sol est un compartiment sensible et des connaissances sur les interactions et la migration des radioéléments dans le sol permettent de développer des modèles pour estimer la contamination de la population et de l'environnement. Actuellement, la plupart des études de terrain sur ce sujet concernent uniquement un ou deux radioéléments, surtout le 137Cs et peu d'études intègrent les paramètres du sol pour expliquer la migration des radioéléments. Le but général de cette étude était une compréhension étendue de la radio-écologie d'une vallée alpine. Notre premier objectif était de décrire la distribution en profondeur de 137Cs, ^Sr, 239+240pu et 241Am dans différents sols alpins en relation avec des éléments stables du sol, dans le but d'identifier des éléments stables qui pourraient servir d'indicateurs pour des horizons accumulateurs. L'objectif de la deuxième partie, qui était la partie centrale de l'étude, était d'estimer le pourcentage d'activité sous forme colloïdale du 239Pu et du 90Sr dans les solutions des sols. De plus nous avons déterminé la nature des colloïdes impliqués dans la fixation du ^Sr et 239Pu. Nous avons ensuite intégré ces résultats dans un modèle de transport développé dans le but de décrire la migration du 239Pu et 90Sr dans le sol. Finalement, nous avons étudié l'absorption de 137Cs et 90Sr par les plantes en fonction de l'espèce et de la compétition avec leur élément analogue stable (K et Ca). Les résultats sur la migration en profondeur du 137Cs ont montré que ce radioélément était généralement retenu en surface, à l'exception d'un sol riche en matière organique dans lequel nous avons observé une nette migration en profondeur. Dans tous les sols, la distribution en profondeur du 137Cs était corrélée avec la distribution du 210Pb. L'absorption du 137Cs par les plantes, était dépendante de la concentration en Κ échangeable dans le sol, le potassium étant un compétiteur. De plus, nous avons observé que les espèces ne réagissaient pas de la même manière aux variations de la concentration de Κ échangeable. En effet, les espèces appartenant aux ordres des Poales et des Rosales étaient plus sensibles aux variations de potassium échangeable dans le sol. Dans tous les sols Le 90Sr était beaucoup plus mobile que le 137Cs. En effet, nous avons observé des accumulations de 90Sr dans des horizons riches en Fe et Al jusqu'à 30 cm de profondeur. De plus, le Cu et le Ni montraient des accumulations dans les mêmes horizons que le 90Sr, indiquant qu'il pourrait être possible d'utiliser ces deux éléments comme analogues pour la migration du 90Sr. D'après le modèle développé, le pic de 90Sr dans les premiers centimètres du sol peut être attribué à du recyclage par les plantes. Le 90Sr en solution était principalement sous forme dissoute dans des solutions de sols peu organique (entre 60 et 100% de 90Sr dissous). Par contre, dans des solutions organiques, un important pourcentage de 90Sr (plus de 40%) était associé aux colloïdes. La migration colloïdale du 90Sr peut donc être significative dans des solutions organiques. Comme pour le 137Cs, l'absorption du 90Sr par les plantes dépendait de la concentration de son analogue chimique dans la fraction échangeable du sol. Par contre, les espèces de plantes étudiées avaient la même sensibilité aux variations de la concentration du calcium échangeable. Le plutonium et l'américium étaient accumulés dans le deuxième horizon du sol et nous avons observé seulement une faible migration plus profondément que 20 cm. Selon le modèle, la migration actuelle du plutonium est très lente et l'absorption par les plantes semble négligeable. Nous avons mesuré entre 0.01 et 0.08 mBq/L de 239Pu dans les solutions de sol brutes. La migration du plutonium par la solution du sol est due principalement aux colloïdes, probablement de nature humique. Résumé grand public Dans les années 1950 à 1960, l'environnement a été contaminé par des éléments radioactifs (radioéléments) artificiels provenant des essais des armes atomiques et de l'industrie nucléaire. En effet, durant ces années, les premiers essais de bombes atomiques se faisaient dans l'atmosphère, libérant de grandes quantités d'éléments radioactifs. De plus certains accidents impliquant l'industrie nucléaire civile ont contribué à la dissémination d'éléments radioactifs dans l'environnement. Ce fut par exemple le cas de l'accident de la centrale atomique de Tchernobyl en 1986 qui a causé une importante contamination d'une grande partie de l'Europe par le 137Cs. Lorsqu'ils sont libérés dans l'atmosphère, les radioéléments sont dispersés et transportés par les courants atmosphériques, puis peuvent être déposés dans l'environnement, principalement par les précipitations. Une fois déposés sur le sol, les radioéléments vont interagir avec les composants du sol et migrer plus ou moins vite. La connaissance des interactions des éléments radioactifs avec le sol est donc importante pour prédire les risques de contamination de l'environnement et de l'homme. Le but général de ce travail était d'évaluer la migration de différents éléments radioactifs (césium-137, strontium-90, plutonium et américium-241) à travers le sol. Nous avons choisi un site d'étude en milieu alpin (Val Piora, Tessin, Suisse), contaminé en radioéléments principalement par les retombées de l'accident de Tchernobyl et des essais atmosphériques de bombes atomiques. Dans un premier temps, nous avons caractérisé la distribution en profondeur des éléments radioactifs dans le sol et l'avons comparée à divers éléments stables. Cette comparaison nous a permit de remarquer que le cuivre et le nickel s'accumulaient dans les mêmes horizons du sol que le strontium-90 et pourraient donc être utilisés comme analogue pour la migration du strontium-90 dans les sols. Dans la plupart des sols étudiés, la migration du césium-137, du plutonium et de l'américium-241 était lente et ces radioéléments étaient donc accumulés dans les premiers centimètres du sol. Par contre, le strontium-90 a migré beaucoup plus rapidement que les autres radioéléments si bien qu'on observe des accumulations de strontium-90 à plus de 30 cm de profondeur. Les radioéléments migrent dans la solution du sol soit sous forme dissoute, soit sous forme colloïdale, c'est-à-dire associés à des particules de diamètre < Ιμηι. Cette association avec des colloïdes permet à des radioéléments peu solubles, comme le plutonium, de migrer plus rapidement qu'attendu. Nous avons voulu savoir quelle était la part de strontium-90 et plutonium associés à des colloïdes dans la solution du sol. Les résultats ont montré que le plutonium en solution était principalement associé à des colloïdes de type organique. Quant au strontium-90, ce dernier était en partie associé à des colloïdes dans des solutions de sol riches en matière organique, par contre, il était principalement sous forme dissoute dans les solutions de sol peu organiques. L'absorption de radioéléments par les plantes représente une voie importante pour le transfert vers la chaîne alimentaire, par conséquent pour la contamination de l'homme. Nous avons donc étudié le transfert du césium-137 et du strontium-90 de plusieurs sols vers différentes espèces de plantes. Les résultats ont montré que l'absorption des radioéléments par les plantes était liée à la concentration de leur analogue chimique (calcium pour le strontium-90 et potassium pour le césium- 137) dans la fraction échangeable du sol. De plus certaines espèces de plantes accumulent significativement moins de strontium-90.

Biomedical risk assessment as an aid for smoking cessation.

BACKGROUND: A possible strategy for increasing smoking cessation rates could be to provide smokers who have contact with healthcare systems with feedback on the biomedical or potential future effects of smoking, e.g. measurement of exhaled carbon monoxide (CO), lung function, or genetic susceptibility to lung cancer. OBJECTIVES: To determine the efficacy of biomedical risk assessment provided in addition to various levels of counselling, as a contributing aid to smoking cessation. SEARCH METHODS: For the most recent update, we searched the Cochrane Collaboration Tobacco Addiction Group Specialized Register in July 2012 for studies added since the last update in 2009. SELECTION CRITERIA: Inclusion criteria were: a randomized controlled trial design; subjects participating in smoking cessation interventions; interventions based on a biomedical test to increase motivation to quit; control groups receiving all other components of intervention; an outcome of smoking cessation rate at least six months after the start of the intervention. DATA COLLECTION AND ANALYSIS: Two assessors independently conducted data extraction on each paper, with disagreements resolved by consensus. Results were expressed as a relative risk (RR) for smoking cessation with 95% confidence intervals (CI). Where appropriate, a pooled effect was estimated using a Mantel-Haenszel fixed-effect method. MAIN RESULTS: We included 15 trials using a variety of biomedical tests. Two pairs of trials had sufficiently similar recruitment, setting and interventions to calculate a pooled effect; there was no evidence that carbon monoxide (CO) measurement in primary care (RR 1.06, 95% CI 0.85 to 1.32) or spirometry in primary care (RR 1.18, 95% CI 0.77 to 1.81) increased cessation rates. We did not pool the other 11 trials due to the presence of substantial clinical heterogeneity. Of the remaining 11 trials, two trials detected statistically significant benefits: one trial in primary care detected a significant benefit of lung age feedback after spirometry (RR 2.12, 95% CI 1.24 to 3.62) and one trial that used ultrasonography of carotid and femoral arteries and photographs of plaques detected a benefit (RR 2.77, 95% CI 1.04 to 7.41) but enrolled a population of light smokers and was judged to be at unclear risk of bias in two domains. Nine further trials did not detect significant effects. One of these tested CO feedback alone and CO combined with genetic susceptibility as two different interventions; none of the three possible comparisons detected significant effects. One trial used CO measurement, one used ultrasonography of carotid arteries and two tested for genetic markers. The four remaining trials used a combination of CO and spirometry feedback in different settings. AUTHORS' CONCLUSIONS: There is little evidence about the effects of most types of biomedical tests for risk assessment on smoking cessation. Of the fifteen included studies, only two detected a significant effect of the intervention. Spirometry combined with an interpretation of the results in terms of 'lung age' had a significant effect in a single good quality trial but the evidence is not optimal. A trial of carotid plaque screening using ultrasound also detected a significant effect, but a second larger study of a similar feedback mechanism did not detect evidence of an effect. Only two pairs of studies were similar enough in terms of recruitment, setting, and intervention to allow meta-analyses; neither of these found evidence of an effect. Mixed quality evidence does not support the hypothesis that other types of biomedical risk assessment increase smoking cessation in comparison to standard treatment. There is insufficient evidence with which to evaluate the hypothesis that multiple types of assessment are more effective than single forms of assessment.

Testing of Old Reinforced Concrete Bridges, HR-390, 1997

The objective of this research project was to service load test a representative sample of old reinforced concrete bridges (some of them historic and some of them scheduled for demolition) with the results being used to create a database so the performance of similar bridges could be predicted. The types of bridges tested included two reinforced concrete open spandrel arches, two reinforced concrete filled spandrel arches, one reinforced concrete slab bridge, and one two span reinforced concrete stringer bridge. The testing of each bridge consisted of applying a static load at various locations on the bridges and monitoring strains and deflections in critical members. The load was applied by means of a tandem axle dump truck with varying magnitudes of load. At each load increment, the truck was stopped at predetermined transverse and longitudinal locations and strain and deflection data were obtained. The strain data obtained were then evaluated in relation to the strain values predicted by traditional analytical procedures and a carrying capacity of the bridges was determined based on the experimental data. The response of a majority of the bridges tested was considerably lower than that predicted by analysis. Thus, the safe load carrying capacities of the bridges were greater than those predicted by the analytical models, and in a few cases, the load carrying capacities were found to be three or four times greater than calculated values. However, the test results of one bridge were lower than those predicted by analysis and thus resulted in the analytical rating being reduced. The results of the testing verified that traditional analytical methods, in most instances, are conservative and that the safe load carrying capacities of a majority of the reinforced concrete bridges are considerably greater than what one would determine on the basis of analytical analysis alone. In extrapolating the results obtained from diagnostic load tests to levels greater than those placed on the bridge during the load test, care must be taken to ensure safe bridge performance at the higher load levels. To extrapolate the load test results from the bridges tested in this investigation, the method developed by Lichtenstein in NCHRP Project 12-28(13)A was used.

Nonlinear Finite Element Study of Piles in Integral Abutment Bridges, HR-227, Part 2, 1982

The highway departments of the states which use integral abutments in bridge design were contacted in order to study the extent of integral abutment use in skewed bridges and to survey the different guidelines used for analysis and design of integral abutments in skewed bridges. The variation in design assumptions and pile orientations among the various states in their approach to the use of integral abutments on skewed bridges is discussed. The problems associated with the treatment of the approach slab, backfill, and pile cap, and the reason for using different pile orientations are summarized in the report. An algorithm based on a state-of-the-art nonlinear finite element procedure previously developed by the authors was modified and used to study the influence of different factors on behavior of piles in integral abutment bridges. An idealized integral abutment was introduced by assuming that the pile is rigidly cast into the pile cap and that the approach slab offers no resistance to lateral thermal expansion. Passive soil and shear resistance of the cap are neglected in design. A 40-foot H pile (HP 10 X 42) in six typical Iowa soils was analyzed for fully restrained pile head and pinned pile head. According to numerical results, the maximum safe length for fully restrained pile head is one-half the maximum safe length for pinned pile head. If the pile head is partially restrained, the maximum safe length will lie between the two limits. The numerical results from an investigation of the effect of predrilled oversized holes indicate that if the length of the predrilled oversized hole is at least 4 feet below the ground, the vertical load-carrying capacity of the H pile is only reduced by 10 percent for 4 inches of lateral displacement in very stiff clay. With no predrilled oversized hole, the pile failed before the 4-inch lateral displacement was reached. Thus, the maximum safe lengths for integral abutment bridges may be increased by predrilling. Four different typical Iowa layered soils were selected and used in this investigation. In certain situations, compacted soil (> 50 blow count in standard penetration tests) is used as fill on top of natural soil. The numerical results showed that the critical conditions will depend on the length of the compacted soil. If the length of the compacted soil exceeds 4 feet, the failure mechanism for the pile is similar to one in a layer of very stiff clay. That is, the vertical load-carrying capacity of the H pile will be greatly reduced as the specified lateral displacement increases.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

The influence of tobacco consumption on the relationship between schizotypy and hemispheric asymmetry.

Tobacco use is positively associated with severity of symptoms along the schizophrenia spectrum. Accordingly it could be argued that neuropsychological performance, formerly thought to be modulated by schizotypy, is actually modulated by drug use or an interaction of drug use and schizotypy. We tested whether habitual cigarette smokers as compared to non-smokers would show a neuropsychological profile similar to that observed along the schizophrenia spectrum and, if so, whether smoking status or nicotine dependence would be more significant modulators of behavior than schizotypy. Because hemispheric dominance has been found to be attenuated along the schizophrenia spectrum, 40 right-handed male students (20 non-smokers) performed lateralized left- (lexical decisions) and right- (facial decision task) hemisphere dominant tasks. All individuals completed self-report measures of schizotypy and nicotine dependence. Schizotypy predicted laterality in addition to smoking status: While positive schizotypy (Unusual Experiences) was unrelated to hemispheric performance, Cognitive Disorganization predicted reduced left hemisphere dominant language functions. These latter findings suggest that Cognitive Disorganization should be regarded separately as a potentially important mediator of thought disorganization and language processing. Additionally, increasing nicotine dependence among smokers predicted a right hemisphere shift of function in both tasks that supports the role of the right hemisphere in compulsive/impulsive behavior.

Retrofit Methods for Distortion Cracking Problems in Plate Girder Bridges, TR-436, 2003

This report is formatted to independently present four individual investigations related to similar web gap fatigue problems. Multiple steel girder bridges commonly exhibit fatigue cracking due to out-of-plane displacement of the web near the diaphragm connections. This fatigue-prone web gap area is typically located in negative moment regions of the girders where the diaphragm stiffener is not attached to the top flange. In the past, the Iowa Department of Transportation has attempted to stop fatigue crack propagation in these steel girder bridges by drilling holes at the crack tips. Other nondestructive retrofits have been tried; in a particular case on a two-girder bridge with floor beams, angles were bolted between the stiffener and top flange. The bolted angle retrofit has failed in the past and may not be a viable solution for diaphragm bridges. The drilled hole retrofit is often only a temporary solution, so a more permanent and effective retrofit is required. A new field retrofit has been developed that involves loosening the bolts in the connection between the diaphragm and the girders. Research on the retrofit has been initiated; however, no long-term studies of the effects of bolt loosening have been performed. The intent of this research is to study the short-term effects of the bolt loosening retrofit on I-beam and channel diaphragm bridges. The research also addressed the development of a continuous remote monitoring system to investigate the bolt loosening retrofit on an X-type diaphragm bridge over a number of months, ensuring that the measured strain and displacement reductions are not affected by time and continuous traffic loading on the bridge. The testing for the first three investigations is based on instrumentation of web gaps in a negative moment region on Iowa Department of Transportation bridges with I-beam, channel, and X-type diaphragms. One bridge of each type was instrumented with strain gages and deflection transducers. Field tests, using loaded trucks of known weight and configuration, were conducted on the bridges with the bolts in the tight condition and after implementing the bolt loosening retrofit to measure the effects of loosening the diaphragm bolts. Long-term data were also collected on the X-diaphragm bridge by a data acquisition system that collected the data continuously under ambient truck loading. The collected data were retrievable by an off-site modem connection to the remote data acquisition system. The data collection features and ruggedness of this system for remote bridge monitoring make it viable as a pilot system for future monitoring projects in Iowa. Results indicate that loosening the diaphragm bolts reduces strain and out-of-plane displacement in the web gap, and that the reduction is not affected over time by traffic or environmental loading on the bridge. Reducing the strain in the web gap allows the bridge to support more cycles of loading before experiencing fatigue, thus increase the service life of the bridge. Two-girder floor beam bridges may also exhibit fatigue cracking in girder webs.

Motility tests for drugs preventing PolyQ aggregation in recombinant Caenorhabditis elegans.

The pathological formation of proteinaceous aggregates that accumulate into the brain cells of patients are hallmarks of neurodegenerative diseases such as Alzheimer's disease, amyotrophic lateral sclerosis and the heterogeneous group of polyglutamine (polyQ) diseases. In the polyQ diseases, the most upstream events of the pathogenic cascade are the misfolding and aggregation of proteins, such as huntingtin in Huntington's disease, that contain expanded stretch of glutamine residues above 35--‐40 repeats. This expanded polyQ stretch triggers the misfolding and aggregation of cytotoxic polyQ proteins in the neurons that cause cell death through different processes, like apoptosis, excessive inflammation, formation of free radicals, eventually leading to neuronal loss and neurodegeneration. This study focuses on the cellular network of chaperone proteins that can prevent protein aggregation by binding misfolding intermediates and may, as in the case of HSP70, actively unfold misfolded proteins into refoldable non--‐toxic ones (Hinault et al., 2010; Sharma et al., 2011). The chaperones can also collaborate with the proteasome to convert stable harmful proteins into harmless amino acids. Thus, the chaperone proteins that are the most important cellular factors of prevention and curing of protein misfolding, are negatively affected by aging (Morley et al., 2002) and fail to act properly in the neurons of aged persons, which eventually may lead to neurodegenerative pathologies. The general aim of this research was to identify least toxic drugs that can upregulate the expression of chaperone genes in cells suffering from polyQ--‐ mediated protein aggregation and degeneration. The specific aim of this study was to observe the effect of ten drugs on polyQ aggregation in a recombinant nematode Caenorhabditis elegans expressing a chimeric protein containing a sequence of 35 glutamines (Q35) fused to the green fluorescent protein in muscle cells, which causes an age--‐ and temperature--‐ dependent phenotype of accelerated paralysis. The drugs were selected after having proven their causing the overexpression of chaperone proteins in a previous wide screening of 2000 drugs on the moss plant Physcomitrella patens. The screening that we performed in this study was on these ten drugs. It suggested that piroxicam and anisindione were good reducers of polyglutamine disease mediated paralysis. A hypothesis can be made that they may act as good enhancers of the heat shock response, which causes the overexpression of many HSP chaperones and thus reduce motility impairment of polyQ disease expressing nematodes. Piroxicam was found to have the greatest effect on reducing polyQ35 proteins aggregates mediated paralysis in a dose--‐dependent manner but was also found to either have a toxic effect on wild type C.elegans, either to change its natural motility behavior, eventually reducing its motility in both cases. Chloroform should be preferred over DMSO as a drug solvent as it appears to be less toxic to C.elegans.

Dynamic Tests of a Three-Span Continuous I-Beam Highway Bridge, HR-43, 1959

This paper presents the results of the static and dynamic testing of a three-span continuous I-beam highway bridge. Live load stress frequency curves for selected points are shown, and the static and dynamic load distribution to the longitudinal composite beam members are given. The bridge has four traffic lanes with a roadway width of 48 ft. Six longitudinal continuous WF beams act compositely with the reinforced concrete slab to carry the live load. The beams have partial length cover plates at the piers. Previous research has indicated that beams with partial length cover plates have a very low fatigue strength. It was found in this research that the magnitude of the stresses due to actual highway loads were very much smaller than those computed from specification loading. Also, the larger stresses which were measured occurred a relatively small number of times. These data indicate that some requirements for reduced allowable stresses at the ends of cover plates are too conservative. The load distribution to the longitudinal beams was determined for static and moving loads and includes the effect of impact on the distribution. The effective composite section was found at various locations to evaluate the load distribution data. The composite action was in negative as well as positive moment regions. The load distribution data indicate that the lateral distribution of live load is consistent with the specifications, but that there is longitudinal distribution, and therefore the specifications are too conservative.

Feasibility Study of Dynamic Overload and Ultimate Load Tests of Full-Scale Highway Bridges, HR-160, 1973

As a result of the construction of the Saylorville Dam and Reservoir on the Des Moines River, six highway bridges are scheduled for removal. Five of these are old high-truss single-lane bridges, each bridge having several simple spans. The other bridge is a fairly modern (1955) double 4-span continuous beam-and-slab composite highway bridge. The availability of these bridges affords an unusual opportunity for study of the behavior of full-scale bridges. Because of the magnitude of the potential testing program, a feasibility study was initiated and the results are presented in this two-part final report. Part I summarizes the findings and Part II presents the supporting detailed information.

Field/Laboratory Testing of Damaged Prestressed Concrete Girder Bridges, HR-397, 1999

Due to frequent accidental damage to prestressed concrete (P/C) bridges caused by impact from overheight vehicles, a project was initiated to evaluate the strength and load distribution characteristics of damaged P/C bridges. A comprehensive literature review was conducted. It was concluded that only a few references pertain to the assessment and repair of damaged P/C beams. No reference was found that involves testing of a damaged bridge(s) as well as the damaged beams following their removal. Structural testing of two bridges was conducted in the field. The first bridge tested, damaged by accidental impact, was the westbound (WB) I-680 bridge in Beebeetown, Iowa. This bridge had significant damage to the first and second beams consisting of extensive loss of section and the exposure of numerous strands. The second bridge, the adjacent eastbound (EB) structure, was used as a baseline of the behavior of an undamaged bridge. Load testing concluded that a redistribution of load away from the damaged beams of the WB bridge was occurring. Subsequent to these tests, the damaged beams in the WB bridge were replaced and the bridge retested. The repaired WB bridge behaved, for the most part, like the undamaged EB bridge indicating that the beam replacement restored the original live load distribution patterns. A large-scale bridge model constructed for a previous project was tested to study the changes in behavior due to incrementally applied damage consisting initially of only concrete removal and then concrete removal and strand damage. A total of 180 tests were conducted with the general conclusion that for exterior beam damage, the bridge load distribution characteristics were relatively unchanged until significant portions of the bottom flange were removed along with several strands. A large amount of the total applied moment to the exterior beam was redistributed to the interior beam of the model. Four isolated P/C beams were tested, two removed from the Beebeetown bridge and two from the aforementioned bridge model. For the Beebeetown beams, the first beam, Beam 1W, was tested in an "as removed" condition to obtain the baseline characteristics of a damaged beam. The second beam, Beam 2W, was retrofit with carbon fiber reinforced polymer (CFRP) longitudinal plates and transverse stirrups to strengthen the section. The strengthened Beam was 12% stronger than Beam 1W. Beams 1 and 2 from the bridge model were also tested. Beam 1 was not damaged and served as the baseline behavior of a "new" beam while Beam 2 was damaged and repaired again using CFRP plates. Prior to debonding of the plates from the beam, the behavior of both Beams 1 and 2 was similar. The retrofit beam attained a capacity greater than a theoretically undamaged beam prior to plate debonding. Analytical models were created for the undamaged and damaged center spans of the WB bridge; stiffened plate and refined grillage models were used. Both models were accurate at predicting the deflections in the tested bridge and should be similarly accurate in modeling other P/C bridges. The moment fractions per beam were computed using both models for the undamaged and damaged bridges. The damaged model indicates a significant decrease in moment in the damaged beams and a redistribution of load to the adjacent curb and rail as well as to the undamaged beam lines.