Use of real-time PCR to evaluate two DNA extraction methods from food

The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R²) demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct) values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

Characterization of spoilage bacteria in pork sausage by PCR-DGGE analysis

To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Extraction of DNA from honey and its amplification by PCR for botanical identification

The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Detection of genetically modified organisms in soy products sold in Turkish market

PCR-based technique for GMO detection is the most reliable choice because of its high sensitivity and specificity. As a candidate of the European Union, Turkey must comply with the rules for launching into the market, traceability, and labeling of GMOs as established by EU legislation. Therefore, the objective of this study is to assess soybean products in the Turkish market to verify compliance with legislation using qualitative Polymerase Chain Reaction (PCR) assay to detect the presence of GM soybean and to quantify its amount of GM soybean in the samples tested positive using real-time PCR. DNA extracted by the modified CTAB method was properly used for PCR amplification of food materials. The amplification of a 118 bp DNA fragment of the lectin gene from soybean by PCR was successfully achieved in all samples. The GMO screening was based on the detection of 35S promoter and NOS terminator sequences. The GM positive samples were subjected to detection of Roundup ReadyTM soybean (RR) using quantitative real-time PCR. It was found that 100% of the tested food samples contained less than 0.1 per cent of EPSPS gene.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Sensibility of the PCR technique in the detection of Stenocarpella sp. associated with maize seeds

Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.

Aikaerotteisesti fluoresenssia mittaavan reaaliaikaisen PCR-laitteen kehitys

Kvantitatiivinen reaaliaikainen polymeraasiketjureaktio (engl. polymerase chain reaction, PCR) on osoittautunut käyttäjäystävällisimmäksi menetelmäksi nukleiinihapposekvenssien kvantitoimisessa. Tätä menetelmää voidaan herkistää pienempien DNA-pitoisuuksien havaitsemiseen käyttämällä hyväksi aikaerotteista fluorometriaa (engl. time-resolved fluorometry, TRF) ja luminoivia lantanidileimoja, joiden fluoresenssin pitkän eliniän ansiosta emission mittaus voidaan suorittaa vasta hetki virittävän valopulssin jälkeen, jolloin lyhytikäinen taustasäteily ehtii sammua. Tuloksena saadaan korkea signaali-taustasuhde. Tämän diplomityön tarkoituksena oli rakentaa TRF:än pystyvä reaaliaikainen PCR-laite, sillä tällaista laitetta ei ole markkinoilla tarjolla. Laite rakennettiin kehittämällä lämpökierrätin ja yhdistämällä se valmiiseen TRF:än kykenevään mittapäähän. Mittapään ja lämpökierrättimen hallitsemiseksi kehitettiin myös tietokoneohjelma. Valon tuottamiseksi ja mittaamiseksi haluttiin käyttää edullisia komponentteja, joten työssä käytettiin valmiin mittapään optiikkaa, jossa viritys tapahtuu hohtodiodilla (engl. light-emitting diode, LED) ja lantanidileiman emission mittaus fotodiodilla (engl. photodiode, PD) tai valomonistinputkella (engl. photomultiplier tube, PMT). Myös mittapään suorituskykyä tutkittiin. Työtä varten kehitettiin lämpökierrätin, joka koostui Peltier-elementillä lämmitettävästä PCR-putkitelineestä ja lämpökannesta. Mittalaitteen suorituskyvyn tutkimiseen käytettiin kelaattikomplementaatioon perustuvaa PCR-tuotteen havaitsemismenetelmää. Kelaattikomplementaatio perustuu kahteen erilliseen oligonukleotidimolekyyliin, joista toiseen on sidottu lantanidi-ioni ja toiseen valoa absorboiva ligandirakenne, jotka yhdessä muodostavat fluoresoivan kokonaisuuden. Kehitetyn lämpökierrättimen todettiin olevan tarpeeksi tarkka sekä tehokas ja sen lämmitys- ja jäähdytysnopeuden maksimeiksi saatiin 2,6 °C/sekunti. Detektorina käytetyn PD:n ei todettu olevan tarpeeksi herkkä emission havainnoimiseksi ja se korvattiin laitteessa PMT:llä. Käytetyllä PCR-määrityksellä kynnyssykleiksi (engl. threshold cycle, Ct) sekä kehitetylle että referenssilaitteelle saatiin 28,4 käyttämällä samaa 100 000 kopion DNA:n aloitusmäärää. Työssä osoitettiin, että on mahdollista kehittää edullisia komponentteja käyttävä, TRF:än pystyvä, reaaliaikainen PCR-laite, joka kykenee vastaavaan Ct-arvoon kuin vertailulaite. PD:n herkkyys ei kuitenkaan riittänyt. Tulokset olivat lupaavia, sillä LED- ja PD-teknologiat kehittyvät ja markkinoille on tullut myös muita komponentteja, joiden avulla on tulevaisuudessa mahdollista kehittää vielä herkempi laite.

« Cinquiesme Livre de Pantagruel, fragment du prologue ».

Commençant par : « Beuveurs infatigables, et vous, verollez horificques, pendant qu'estes de loisir... » et finissant par : «... enfin trouvasmes noz navires au port » .

« Cinquiesme Livre de Pantagruel, fragment du prologue ».

Commençant par : « Beuveurs infatigables, et vous, verollez horificques, pendant qu'estes de loisir... » et finissant par : «... enfin trouvasmes noz navires au port » .

Du Pronostic de l'épilepsie et du traitement de cette maladie par le valérianate d'atropine, fragment d'un mémoire lu devant l'Académie impériale de médecine, par le Dr Michéa,... précédé d'un extrait du rapport de l'Académie sur ce mémoire

Comprend : Académie impériale de médecine. (Séance du 22 janvier 1856.) Extrait du Rapport fait par M. Jolly... sur un travail de M. le Dr Michéa ayant pour titre : "De l'Application des principes actifs de la valériane et de la belladone dans le traitement de quelques affections convulsives"

Boethius, De institutione arithmetica, cum commentariis (2-36). - Gerbertus Remensis, Scholium ad Boethii Arithmeticam Institutionem, lib. II, cap. 1 (36) [fragment].

Au f. 36, une main du XIIIe s. a ajouté un passage du traité de Gerbert intitulé "Scholium ad Boethii Arithmeticam Institutionem".

Explication de l'Exode par Nicolas de Tournai. - Fragment de la règle de s. Benoit (135).

Célestins.