A non-classical LysR-type transcriptional regulator PA2206 is required for an effective oxidative stress response in Pseudomonas aeruginosa

LysR-type transcriptional regulators (LTTRs) are emerging as key circuit components in regulating microbial stress responses and are implicated in modulating oxidative stress in the human opportunistic pathogen Pseudomonas aeruginosa. The oxidative stress response encapsulates several strategies to overcome the deleterious effects of reactive oxygen species. However, many of the regulatory components and associated molecular mechanisms underpinning this key adaptive response remain to be characterised. Comparative analysis of publically available transcriptomic datasets led to the identification of a novel LTTR, PA2206, whose expression was altered in response to a range of host signals in addition to oxidative stress. PA2206 was found to be required for tolerance to H2O2 in vitro and lethality in vivo in the Zebrafish embryo model of infection. Transcriptomic analysis in the presence of H2O2 showed that PA2206 altered the expression of 58 genes, including a large repertoire of oxidative stress and iron responsive genes, independent of the master regulator of oxidative stress, OxyR. Contrary to the classic mechanism of LysR regulation, PA2206 did not autoregulate its own expression and did not influence expression of adjacent or divergently transcribed genes. The PA2214-15 operon was identified as a direct target of PA2206 with truncated promoter fragments revealing binding to the 5'-ATTGCCTGGGGTTAT-3' LysR box adjacent to the predicted -35 region. PA2206 also interacted with the pvdS promoter suggesting a global dimension to the PA2206 regulon, and suggests PA2206 is an important regulatory component of P. aeruginosa adaptation during oxidative stress.

Caractérisation du potentiel de champ locale dans le cortex préfrontal médian du rat durant le stress et la prise alimentaire

Le stress joue un rôle important dans le maintien de la qualité de vie quotidienne. Une exposition à une situation stressante peut causer divers désordres neuropsychiatriques du cerveau qui sont associés avec des problèmes liés au sommeil, à la dépression, à des problèmes digestifs et à des troubles de l’alimentation. Les traitements de ces troubles liés au stress sont très coûteux à travers le monde. De nos jours, des considérations importantes ont été soulevées afin de trouver des moyens appropriés pour la prévention plutôt que de dépenser ultérieurement plus de budget sur les traitements. De cette façon, l’étude et l’expérimentation sur les animaux des troubles liés au stress sont l’un des moyens les plus fiables pour atteindre une compréhension plus profonde des problèmes liés au stress. Ce projet visait à révéler la modulation des potentiels de champ locaux (LFP) lors de la consommation de sucrose dans deux conditions englobant la condition de contrôle non-stressante et celle stressante d’un choc électrique aiguë à la patte dans le cortex préfrontal médian (CPFm) du cerveau de rat. Le CPFm est une structure importante dans la réponse au stress et à l’anxiété par l’interaction avec l’axe hypothalamique-pituitaire surrénale (HPA). Les résultats de ce projet ont révélé que la plupart des coups de langue se sont produits dans les 15 premières minutes de l’accès à une solution de sucrose autant pour la condition contrôle non-stressante que pour la condition stressante. En outre, le stress aigu d’un choc à la patte affecte de manière significative la consommation horaire de sucrose en diminuant le volume de la consommation. Les résultats ont également révélé une présence importante du rythme thêta dans le CPFm pendant la condition de base et pendant l’ingestion de sucrose dans les deux conditions. De plus, les résultats ont montré une diminution de puissance des bandes delta et thêta lors des initiations de léchage du sucrose. Ce projet conduit à des informations détaillées sur les propriétés électrophysiologiques du cortex infra-limbique (IL) du CPFm en réponse à l’exposition à des conditions de stress et de l’apport d’une solution de sucrose. Ce projet permet également de mieux comprendre les mécanismes neurophysiologiques des neurones du CPFm en réponse à l’exposition à une condition stressante suivie d’apport de sucrose. Ce projet a également permis de confirmer les effets anorexigènes du stress et suggèrent également que la synchronisation neuronale dans le cortex IL peut jouer un rôle dans le comportement de léchage et sa désynchronisation pendant le léchage après une exposition à des conditions stressantes.

The influence of nursing student characteristics on performance in the Quebec licensing exam.

This study examines whether certain academic, demographic or psychosocial characteristics of students can be indicators of future success on the Provincial Nursing Licensing exam. A cohort of 42 third year Nursing students was the study sample. Data were collected using a self-reporting questionnaire, academic marks, and graduate interviews. Academic variables that were studied included: first year nursing marks, college biology marks, final year nursing marks, and literacy level. Demographic variables that were studied included : age, gender, socioeconomic status and level of life responsabilities, academic motivation (hours spent studying) and hours worked at unrelated employment. Lastly, psychosocial variables that were studied included: test taking anxiety, stress and overall confidence level in terms of success on the upcoming exam. A comparison was then undertaken between the two groups-students that passed and students that failed the Licensing exam on their first sitting-with respect to specific student characteristics. The conceptual framework for this study is based on Leinbach and Jenkin's model of the correlation of milestones to momentum points in the educational experience. Results of this study suggest that exam anxiety and content review in the months that follow graduation seem to affect exam performance. Also, certain demographic characteristics such as age and financial strain seemed to be good indicators of future success.||Résumé : Cette étude tente d'établir si certaines caractéristiques liées aux études ainsi que des caractéristiques démographiques ou psychosociales des étudiantes et des étudiants peuvent être indicatives du succès futur à l'examen professionnel provincial d'admission à la profession infirmière. Une cohorte de 42 étudiantes et étudiants de troisième année en sciences infirmières formait l'échantillon de l'étude. Les données ont été recueillies au moyen d'un questionnaire d'autoévaluation, des résultats scolaires et d'entrevues avec les infirmières et infirmiers gradués. Les variables liées aux études examinées ont été les résultats de la première année d'études en sciences infirmières, les résultats en biologie au collégial, les résultats de la dernière année d'études en sciences infirmières et le niveau de littératie. Les variables démographiques étudiées ont été l'âge, le sexe, le statut socioéconomique, le niveau de responsabilités sociales, la motivation dans les études (les heures passées à étudier) et les heures consacrées à un travail non lié aux études. Enfin, les variables psychosociales examinées ont été l'anxiété devant l'examen, le stress et le niveau général de confiance quant à la réussite de l'examen à venir. Une comparaison des deux groupes d'étudiantes et d'étudiants, soit ceux qui ont réussi l'examen et ceux qui l'ont échoué à leur première tentative, a ensuite été faite en tenant compte des caractéristiques particulières à chacun. Le cadre conceptuel de cette étude repose sur le modèle de la corrélation entre les jalons (milestones) et les accomplissements (momentum points) dans l'expérience des études de Leinbach and Jenkin. Les résultats de cette étude laissent entendre que l'anxiété devant l'examen et la révision de la matière dans les mois suivant l'obtention du diplôme semblent avoir un effet sur le rendement à l'examen. Aussi, certaines caractéristiques démographiques comme l'âge et les difficultés financières semblaient être indicatifs du succès futur.

Leaf water potential and sap flow as indicators of water stress in Crimson ‘seedless’ grapevines under different irrigation strategies

Vitis vinifera L. cv. Crimson Seedless is a late season red table grape developed in 1989, with a high market value and increasingly cultivated under protected environments to extend the availability of seedless table grapes into the late fall. The purpose of this work was to evaluate leaf water potential and sap flow as indicators of water stress in Crimson Seedless vines under standard and reduced irrigation strategy, consisting of 70 % of the standard irrigation depth. Additionally, two sub-treatments were applied, consisting of normal irrigation throughout the growing season and a short irrigation induced stress period between veraison and harvest. Leaf water potential measurements coherently signaled crop-available water variations caused by different irrigation treatments, suggesting that this plant-based method can be reliably used to identify water-stress conditions. The use of sap flow density data to establish a ratio based on a reference ‘well irrigated vine’ and less irrigated vines can potentially be used to signal differences in the transpiration rates, which may be suitable for improving irrigation management strategies while preventing undesirable levels of water stress. Although all four irrigation strategies resulted in the production of quality table grapes, significant differences (p ≤ 0.05) were found in both berry weight and sugar content between the standard irrigation and reduced irrigation treatments. Reduced irrigation increased slightly the average berry size as well as sugar content and technical maturity index. The 2-week irrigation stress period had a negative effect on these parameters.

Leaf water potential and sap flow as indicators of water stress in Crimson 'seedless' grapevines under different irrigation strategies

Abstract Vitis vinifera L. cv. Crimson Seedless is a late season red table grape developed in 1989, with a high market value and increasingly cultivated under protected environments to extend the availability of seedless table grapes into the late fall. The purpose of this work was to evaluate leaf water potential and sap flow as indicators of water stress in Crimson Seedless vines under standard and reduced irrigation strategy, consisting of 70 % of the standard irrigation depth. Additionally, two sub-treatments were applied, consisting of normal irrigation throughout the growing season and a short irrigation induced stress period between veraison and harvest. Leaf water potential measurements coherently signaled crop-available water variations caused by different irrigation treatments, suggesting that this plant-based method can be reliably used to identify water-stress conditions. The use of sap flow density data to establish a ratio based on a reference ‘well irrigated vine’ and less irrigated vines can potentially be used to signal differences in the transpiration rates, which may be suitable for improving irrigation management strategies while preventing undesirable levels of water stress. Although all four irrigation strategies resulted in the production of quality table grapes, significant differences (p ≤ 0.05) were found in both berry weight and sugar content between the standard irrigation and reduced irrigation treatments. Reduced irrigation increased slightly the average berry size as well as sugar content and technical maturity index. The 2-week irrigation stress period had a negative effect on these parameters.

Linking thermal imaging to physiological indicators in Carica papaya L. under different watering regimes

Water deficit is the most limiting factor for yield and fruit-quality parameters in papaya crop (Carica papaya L.), deficit-irrigation (DI) strategies offering a feasible alternative to manage limiting water resources. When DI is applied, it is crucial to assess the physiological status of the crop in order to maintain the plant within a threshold value of water stress so as no to affect yield or fruit-quality parameters. The aim of this work was to evaluate the feasibility of thermal imaging in young papaya plants to assess the physiological status of this crop when it is subjected to different DI regimes, studying the relationships between the changes in leaf temperature (Tleaf) and in the major physiological parameters (i.e., stomatal conductance to water vapor, gs; transpiration, E; and net photosynthesis, An). The trial was conducted in a greenhouse from March to April of 2012. Plants were grown in pots and subjected to four irrigation treatments: (1) a full irrigation treatment (control), maintained at field capacity; (2) a partial root-zone drying treatment, irrigated with 50% of the total water applied to control to only one side of roots, alternating the sides every 7 days; (3) a regulated deficit irrigation (50% of the control, applied to both sides of plant); (4) and a non-irrigated treatment, in which irrigation was withheld from both sides of the split root for 14 days, followed by full irrigation until the end of the study. Significant relationships were found between Tleaf and major physiological variables such as gs, E and An. Additionally, significant relationships were found between the difference of leaf-to-air temperature (ΔTleaf–air) and gas-exchange measurements, which were used to establish the optimum range of ΔTleaf–air as a preliminary step to the crop-water monitoring and irrigation scheduling in papaya, using thermal imaging as the main source of information. According to the results, we conclude that thermal imaging is a promising technique to monitor the physiological status of papaya during drought conditions.

Linking thermal imaging to physiological indicators in Carica papaya L. under different watering regimes

Water deficit is the most limiting factor for yield and fruit-quality parameters in papaya crop (Carica papaya L.), deficit-irrigation (DI) strategies offering a feasible alternative to manage limiting water resources. When DI is applied, it is crucial to assess the physiological status of the crop in order to maintain the plant within a threshold value of water stress so as no to affect yield or fruit-quality parameters. The aim of this work was to evaluate the feasibility of thermal imaging in young papaya plants to assess the physiological status of this crop when it is subjected to different DI regimes, studying the relationships between the changes in leaf temperature (Tleaf) and in the major physiological parameters (i.e., stomatal conductance to water vapor, gs; transpiration, E; and net photosynthesis, An). The trial was conducted in a greenhouse from March to April of 2012. Plants were grown in pots and subjected to four irrigation treatments: (1) a full irrigation treatment (control), maintained at field capacity; (2) a partial root-zone drying treatment, irrigated with 50% of the total water applied to control to only one side of roots, alternating the sides every 7 days; (3) a regulated deficit irrigation (50% of the control, applied to both sides of plant); (4) and a non-irrigated treatment, in which irrigation was withheld from both sides of the split root for 14 days, followed by full irrigation until the end of the study. Significant relationships were found between Tleaf and major physiological variables such as gs, E and An. Additionally, significant relationships were found between the difference of leaf-to-air temperature (ΔTleaf–air) and gas-exchange measurements, which were used to establish the optimum range of ΔTleaf–air as a preliminary step to the crop-water monitoring and irrigation scheduling in papaya, using thermal imaging as the main source of information. According to the results, we conclude that thermal imaging is a promising technique to monitor the physiological status of papaya during drought conditions.

Diffusive models and chaos indicators for non-linear betatron motion in circular hadron accelerators

Understanding the complex dynamics of beam-halo formation and evolution in circular particle accelerators is crucial for the design of current and future rings, particularly those utilizing superconducting magnets such as the CERN Large Hadron Collider (LHC), its luminosity upgrade HL-LHC, and the proposed Future Circular Hadron Collider (FCC-hh). A recent diffusive framework, which describes the evolution of the beam distribution by means of a Fokker-Planck equation, with diffusion coefficient derived from the Nekhoroshev theorem, has been proposed to describe the long-term behaviour of beam dynamics and particle losses. In this thesis, we discuss the theoretical foundations of this framework, and propose the implementation of an original measurement protocol based on collimator scans in view of measuring the Nekhoroshev-like diffusive coefficient by means of beam loss data. The available LHC collimator scan data, unfortunately collected without the proposed measurement protocol, have been successfully analysed using the proposed framework. This approach is also applied to datasets from detailed measurements of the impact on the beam losses of so-called long-range beam-beam compensators also at the LHC. Furthermore, dynamic indicators have been studied as a tool for exploring the phase-space properties of realistic accelerator lattices in single-particle tracking simulations. By first examining the classification performance of known and new indicators in detecting the chaotic character of initial conditions for a modulated Hénon map and then applying this knowledge to study the properties of realistic accelerator lattices, we tried to identify a connection between the presence of chaotic regions in the phase space and Nekhoroshev-like diffusive behaviour, providing new tools to the accelerator physics community.

Valutazione non invasiva dell'epatopatia Fontan indotta

Introduzione: L’intervento di Fontan comporta un aumento istantaneo della pressione venosa centrale che causa, nel medio-lungo termine, una forma di epatopatia specifica detta FALD. Il monitoraggio della FALD è complesso ma potrebbe consentire di bloccarne o rallentarne l’insorgenza. Lo studio ha valutato l’efficacia delle modalità di monitoraggio non invasivo. Materiale e metodi: Sei pazienti (età media 24 anni) operati presso l’IRCCS Azienda Ospedaliero Universitaria di Bologna sono stati sottoposti a RMN 4D-Flow e ad Ecodoppler epatico. Sono stati raccolti i dati anagrafici, morfologici, anamnestici e i markers sierologici per il calcolo degli scores MELD-XI, APRI, FIB4, i valori di Shear Stress assiale e circonferenziale e gli indici di pulsatilità e resistenza delle arterie epatica e renale. Risultati: Il tempo trascorso tra la Fontan e lo studio è stato di 17,8 anni. Età media alla Fontan 6,8 anni. Tutti i pazienti avevano un quadro compatibile con epatopatia. I markers sierologici e gli scores MELD-XI,APRI e FIB4 si sono dimostrati di scarsa utilità. All’ecografia tutti i pazienti avevano ecostruttura irregolare, splenomegalia e valori elevati di pulsatilità e resistenza dell’arteria epatica e splenica. La rigidità epatica media è stata di 12,4 Kpa. Alla RMN 4DF lo Shear stress assiale è stato massimo a livello del condotto (0,16 Pa) e minimo a livello delle vene sovra epatiche (0,05 Pa). Lo Shear Stress si è mostrato massimo nei pazienti con emodinamica sfavorevole e peggior quadro ecografico addominale, evidenziando aree di inefficienza energetica. Conclusioni: La combinazione delle diagnostiche di imaging non invasive potrebbe rivelarsi adeguata per il monitoraggio della FALD. In particolare, la RMN 4D Flow potrebbe rivelare aree di inefficienza energetica predisponenti alla FALD. Questo potrebbe indirizzare in modo specifico la terapia dei pazienti operati o addirittura indurre la modifica del disegno della Fontan verso forme più efficienti.

Fatty Acid Synthase Inhibitors Induce Apoptosis In Non-tumorigenic Melan-a Cells Associated With Inhibition Of Mitochondrial Respiration.

The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat induce apoptosis in non-tumorigenic cells via mitochondrial dysfunction, independent of FASN inhibition.

[factors Associated With Satisfaction With Life Among Elderly Caregivers And Non-caregivers].

This article seeks to investigate associations between satisfaction with life and sociodemographic variables, health conditions, functionality, social involvement and social support among elderly caregivers and non-caregivers, as well as between satisfaction and the intensity of stress in the caregiver group. A sample of 338 caregivers was selected according to two items of the Brazilian version of the Elders Life Stress Inventory. A comparison-group of elderly non-caregivers was selected at random, with a similar gender, age and income profile. Data were derived from self-reported questionnaires and scales. Elderly caregivers with low levels of satisfaction and high levels of stress revealed more symptoms of insomnia, fatigue, diseases and worse IADL performance. Those with greater satisfaction and less stress revealed a good level of social support. Insomnia, depression and fatigue were associated with low satisfaction among caregivers, and with fatigue, depression and low social support among non-caregivers. It was considered relevant that instrumental, psychological and informative support can improve the quality of life and the quality of care provided by elderly caregivers, especially if they are affected by unfavorable health and psychosocial conditions and low satisfaction with life.

Activation Of The Low Molecular Weight Protein Tyrosine Phosphatase In Keratinocytes Exposed To Hyperosmotic Stress.

Herein, we provide new contribution to the mechanisms involved in keratinocytes response to hyperosmotic shock showing, for the first time, the participation of Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP) activity in this event. We reported that sorbitol-induced osmotic stress mediates alterations in the phosphorylation of pivotal cytoskeletal proteins, particularly Src and cofilin. Furthermore, an increase in the expression of the phosphorylated form of LMWPTP, which was followed by an augment in its catalytic activity, was observed. Of particular importance, these responses occurred in an intracellular milieu characterized by elevated levels of reduced glutathione (GSH) and increased expression of the antioxidant enzymes glutathione peroxidase and glutathione reductase. Altogether, our results suggest that hyperosmostic stress provides a favorable cellular environment to the activation of LMWPTP, which is associated with increased expression of antioxidant enzymes, high levels of GSH and inhibition of Src kinase. Finally, the real contribution of LMWPTP in the hyperosmotic stress response of keratinocytes was demonstrated through analysis of the effects of ACP1 gene knockdown in stressed and non-stressed cells. LMWPTP knockdown attenuates the effects of sorbitol induced-stress in HaCaT cells, mainly in the status of Src kinase, Rac and STAT5 phosphorylation and activity. These results describe for the first time the participation of LMWPTP in the dynamics of cytoskeleton rearrangement during exposure of human keratinocytes to hyperosmotic shock, which may contribute to cell death.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Deep Water Running para redução da gordura corporal em mulheres na meia idade : estudo de intervenção em Campinas - SP

Universidade Estadual de Campinas . Faculdade de Educação Física

Fatores de stress em jogadores de futebol profissional

Universidade Estadual de Campinas . Faculdade de Educação Física