963 resultados para Decay fungus


Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The extract of stevia leaves (Stevia rebaudiana Bertoni) is the only sweetener utilized in sucrose substitution which can be produced totally in Brazil. The objective of this study, was determine the temporal characteristic of sweet and bitter taste of stevia and compare with sucrose at 3 and 10% in the same equi-sweet. The time-intensity curves (T-I) for each substance were collected through the software Sistema de Coleta de Dados Tempo-Intensidade - SCDTI for Windows, where the judges recorded through of mouse the perception of each stimuli inside function of time, for each sample. The parameters of T-I curves collected were: time for intensity maxim (TImax), intensity maxim (Imax), time of decay (Td), time of plato (Platô), area under curve (Area) and total time of stimuli duration (Ttot). The parameters Td, Ttot, Area e Plato of T-I curves, for stimuli sweet in both sweetness level, were significativelly superior for stevia, while Timax e Imax were significativelly inferior (p£0,05), at differences between value for both substances were superior DESS at 10%. Sucrose didn?t present any record for simuli bitter as 3 as 10%, while stevia presented a characteristic T-I curve with intensity and total time of stimuli duration dependent of concentration.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O objetivo foi analisar experiência de cárie dentária na população ribeirinha residente às margens dos rios Machado e Preto (Rondônia, Brasil), em 2005 e 2006. Foram examinados 469 indivíduos com formulário preconizado pela Organização Mundial da Saúde, sob luz natural e utilização de espátulas de madeira e sonda CPI. Na faixa etária de 4-5 anos de idade, ceod = 4,30 e 19,64% livres de cárie; 6-10 anos, CPOD = 1,04, ceod = 3,52, 17,05% livres de cárie; aos 12 anos, CPOD = 2,65 e 30,76% livres de cárie; aos 18 anos, CPOD = 5,41 e 19,51% livres de cárie; 35-44 anos, CPOD = 17,74 e 2,98% livres de cárie; 65-74 anos, CPOD = 21,56 e 4,34% livres de cárie. Na análise por componentes, constatou-se que o componente cariado tem maior prevalência nas idades de 0-3, 4-5, 6-10, 12 e 18 anos. Em adultos e idosos, o componente que mais contribui é o perdido. Conclui-se que a população apresenta índices de cárie dentária elevados, sendo necessária a atuação em âmbito educativo, preventivo e curativo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A desintegração radioativa é um processo aleatório e a estimativa de todas as medidas associadas é governada por leis estatísticas. Os perfis de taxas de contagem são sempre "ruidosos" quando utilizados períodos curtos como um segundo para cada medida. Os filtros utilizados e posteriormente as correções feitas no processamento atual de dados gamaespectrométricos não são suficientes para remover ou diminuir, consideravelmente, o ruído oriundo do espectro. Dois métodos estatísticos que atuam diretamente nos dados coletados, isto é, nos espectros, vêm sendo sugeridos na literatura para remover e minimizar estes ruídos remanescentes o Noise-Adjusted Singular Value Decomposition - NASVD e Maximum Noise Fraction - MNF. Estes métodos produzem uma redução no ruído de forma significativa. Neste trabalho eles foram implementados dentro do ambiente de processamento do software Oasis Montaj e aplicados na área compreendida pelos blocos I e II do levantamento aerogeofísico que recobre a porção oeste da Província Mineral do Tapajós, entre os Estados do Pará e Amazonas. Os dados filtrados e não-filtrados com as técnicas de NASVD e MNF foram processados com os parâmetros e constantes fornecidos pela empresa Lasa Engenharia e Prospecções S.A., sendo estes comparados. Os resultados da comparação entre perfis e mapas apresentaram-se de forma promissora, pois houve um ganho na resolução dos produtos.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The absorption spectra of DPH at fixed concentration do not change with water content in organic solvents. It exhibits monomer bands, such as those obtained in ethanol. The absorption did not change for solutions up to 54 and 46% of water in ethanol and DMSO, respectively, for [DPH] = 5.0 × 10-6 mol L-1 at 30 °C. However, at the same experimental conditions, a gradual sharp decay of the DPH fluorescence is observed. It is proposed that water molecules below these water concentration limits act as quenchers of the excited states of DPH. Stern-Volmer quenching constants by intensities measurements are 7.4 × 10-2 (water/ethanol) and 2.6 × 10-2 L mol-1 (water/DMSO). DPH lifetime measurements in the absence and presence of water resulted in 7.1 × 10-2 L mol-1 in water/ethanol, which pointed out that the process is a dynamic quenching by water molecules. For experiments using DPH as probe, this process can affect data, leading to misunderstanding interpretation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Polyethyleneglycol (PEG) was photooxidized in a photo-Fenton system and results compared with the dark reaction. The products were analysed using GPC and HPLC. In the absence of light, PEG samples needed 490 min to reduce their w by 50%, whereas under UV irradiation, only 10 min were necessary. The exponential decay of w with a concomitant increase in polydispersity and number of average chain scission, characterized a random chain scission mechanism. The degradation products of PEG in both systems showed the presence of lower molecular weight products, including smaller ethyleneglycols and formic acid. The mechanism involves consecutive processes, were the larger ethyleneglycols give rise, successively, to smaller ones. This suggests that the mechanism involves successive scissions of the polymer chain. Irradiated samples decomposed faster than those kept in the dark This study proves that the foto-Fenton method associated with UV-light is a good reactant for PEG photodegradation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Films of poly (2,5-dicyano-p-phenylene vinylene), DCNPPV, were obtained by electrochemical synthesis over gold thin layer (20 nm) transparent electrode deposited on a glass plate. The DCNPPV films of 4 µm thickness were produced by electropolymerization process of α,α,α',α'-tetrabromo-2-5-dicyano-p-xilene at different applied potentials (-0.15, -0.25, -0.40, -0.60, -0.80, and -1.0 V) using 0.1 mol L-1 of tetraethylammonium bromide in acetonitrile as the supporting electrolyte. The emission decays have three exponential components: a fast component in the picosecond range (200-400 ps), and two other of about one and five nanoseconds at 293 K. The fluorescence quenching process seems to occur by exciton trapping in a low-energy site and quenching by residual bromine monomer attached at the end of the polymer chain. However, the electrochemical synthesis generates entrapped bromide or ion pairs during the growth step of the film which also contributes to the deactivation. The change of the electrolyte from bromide to perchlorate reduces significantly this additional quenching effect by allowing ion exchange of formed bromide with the nonquenching perchloride anion.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O objetivo deste trabalho foi avaliar o efeito de duas temperaturas e condições de atmosfera controlada (AC) sobre a conservação de pêssegos da cultivar Maciel, colhidos em dois estádios de maturação. Os tratamentos avaliados foram: armazenamento refrigerado (AR) na temperatura de +0,5°C; AR na temperatura de -0,5°C; 2,0kPa O2 + 4,0kPa CO2 em -0,5°C; 1,0kPa O2 + 3,0kPa CO2 em -0,5°C; 2,0kPa O2 + 6,0kPa CO2 em -0,5°C. As avaliações foram realizadas após 60 dias de armazenamento e mais dois e quatro dias de exposição dos frutos à temperatura de 20ºC. Na análise realizada após dois meses de armazenamento, mais dois dias a 20°C, verificou-se que os frutos submetidos a 2,0kPa de O2 + 4,0 kPa de CO2 apresentaram maior firmeza de polpa em relação aos demais tratamentos, sendo que a mesma não foi influenciada pelo estádio de maturação. Os sólidos solúveis totais foram maiores em frutos com estádio de maturação maduro independente da condição de armazenamento. A ocorrência de podridões e escurecimento interno da polpa não foi influenciada pelo estádio de maturação. No entanto, a condição de AC de 1,0 kPa de O2 + 3,0kPa de CO2 proporcionou o menor percentual de podridões e escurecimento interno da polpa em relação aos demais tratamentos. Na avaliação realizada aos quatro dias de exposição a 20°C, os frutos colhidos no estádio maduro estavam completamente podres, independente da condição de armazenamento praticada.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Using series solutions and time-domain evolutions, we probe the eikonal limit of the gravitational and scalar-field quasinormal modes of large black holes and black branes in anti-de Sitter backgrounds. These results are particularly relevant for the AdS/CFT correspondence, since the eikonal regime is characterized by the existence of long-lived modes which (presumably) dominate the decay time scale of the perturbations. We confirm all the main qualitative features of these slowly damped modes as predicted by Festuccia and Liu [G. Festuccia and H. Liu, arXiv:0811.1033.] for the scalar-field (tensor-type gravitational) fluctuations. However, quantitatively we find dimensional-dependent correction factors. We also investigate the dependence of the quasinormal mode frequencies on the horizon radius of the black hole (brane) and the angular momentum (wave number) of vector- and scalar-type gravitational perturbations.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper revisits the design of L and S band bridged loop-gap resonators (BLGRs) for electron paramagnetic resonance applications. A novel configuration is described and extensively characterized for resonance frequency and quality factor as a function of the geometrical parameters of the device. The obtained experimental results indicate higher values of the quality factor (Q) than previously reported in the literature, and the experimental analysis data should provide useful guidelines for BLGR design.