953 resultados para metal complexes


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The novel NS-containing zirconacycle complexes Cp2ZrCl[SC(H)NR] (1a, R = C6H5; 1b, R = 2-C10H7; 1c, R= C-C6H11; 1d; R = n-C4H9) were obtained by insertion reactions of Cp2Zr(H)Cl with RNCS. 1(a-d) could react further with Cp2Zr(H)Cl to yield a sulphur-bridging compleX (Cp2ZrCl)2S (2) and a Schiff base RN=CH2. The crystal structure of la has been determined by X-ray analysis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The H+, Li+, Na+, K+, Mg2+, Ca2+ and Ba2+ ion transfer across the water/nitrobenzene (NB) and water/1,2-dichloroethane (DCE) interfaces, facilitated by the ionophore ETH157, has been investigated by cyclic voltammetry (CV). The mechanism of the transfer process has been discussed, and the diffusion coefficients and the stability constants of the complexes formed in the nitrobenzene phase have been determined.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Six compounds of M2F3 center dot 1.2H(2)O (M=EU, Ga, Tb, Y, Er, LU: H2F=Fumaric acid) have been synthesized. The structures of Eu(III), T b(III), Y(III), Er(III) and Lu(III) compounds have been determined by singal crystal X-ray diffraction method. The complex of Eu(III) crystallizes in tri-clinic space group P (1) over bar, and the coordination number of Eu3+ is ten. The other four complexes crystallize in monclinic space P2(1)/c, and the coordination numbers of the metal ions are eight. Each of the complexes shows a three-dimensional net structures.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

New bis (2-methoxyethylcyclopentadienyl) yttrium and ytterbium tetrahydroborates (Ln = Y, 1; Yb, 2) have been synthesized in good yield by the reaction of bis (2-methoxyethylcyclopentadienyl) lanthanide chlorides (Ln = Y, Yb) with sodium borohydride in THF at room temperature. The title complexes were characterized by elemental analyses, MS, H-1 NMR and IR spectra. The crystal structures of 1 and 2 have been determined by X-ray diffraction. 1 crystallizes from THF-n-Hexane in space group Pna2(1) with unit cell parametert: a = 1.2390(3), b = 1.1339(2), c = 1.1919 (2) nm and V = 1.6745(6) nm3 with z = 4 for D(c) = 1.39 g.cm-3.The structure was solved by direct method and refined to final R = 0.061 (for 1730 observed reflections). The Space group of 2 is Pna2(1) with unit cell parameters: a = 1.2399(6), b = 1.1371(5), c = 1.1897(2) nm and V = 1.6773(1) nm3 with z = 4 for D(c) = 1.72 g.cm-3, R = 0.038 (for 2157 observed reflections). The X ray structures and IR reveal the bidentate yttrium and ytterbium tetrahydroborate complexes with the intramolecular coordination bonds between lanthanide metal and ligand oxygen atoms.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

By the reaction of Cp3Ln (Cp = C5H5; Ln = Dy, Ho, Yb) with equimolar n-propyl alcohol in THF (tetrahydrofuran) at room temperature three new binuclear organolanthanide complexes, [CP2Ln(mu-OCH2CH2CH3)]2 (Ln = Dy, Ho, Yb), have been synthesized, as shown by X-ray single-crystal structure analysis for the complex [Cp2Yb(mu-OCH2CH2CH3)]2. All the complexes were characterized by elemental analysis, IR and MS spectra. The Yb2O2 unit is planar, and the ytterbium atom is coordinated by two Cp ring centroids and two oxygen atoms of two n-propyloxide ligands to form a distorted tetrahedral geometry. The average Yb-C (Cp) bond distance is 2.589(17) angstrom. The average Yb-O distance is 2.199(5) angstrom. The Yb-Yb separation [3.521(1) angstrom] indicates that no metal-metal interaction is present.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The transfer of H+, Li+, Na+, Zn2+, Mg2+ and Cu2+ facilitated by ionophore ETH 129 (N, N, N', N'-tetracyolohexyl-3-oxapentanediamide) across water/nitrobenzene interface has been studied by the cyclic voltammetry. The mechanism of the transfer process has been discussed. The diffusion coefficients and the stability constants of the complexes formed in the nitrobenzene phase have been determined.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Reaction of lanthanoid trichloride with two equivalents of sodium t-butylcyclopentadienide in tetrahydrofuran affords bis(t-butylcyclopentadienyl)lanthanoid chloride complexes (t-BuCp)2LnCl. nTHF (Ln = Pr, Nd, n = 2; Ln = Gd, Yb, n = 1). The compound (t-BuCp)2PrCl.2THF (1) crystallizes from THF in monoclinic space group P2(1)/c with unit cell dimensions a = 15.080(3), b = 8.855(2), c = 21.196(5) angstrom, beta = 110.34(2)degrees, V = 2653.9 angstrom-3 and D(calcd) = 1.41 g/cm3 for Z = 4. The central metal Pr is coordinated to two t-BuCp ring centroids, one chlorine atom and two THF forming a distorted trigonal bipyramid. The crystal of (t-BuCp)2YbCl.THF (2) belongs to the monoclinic crystal system, space group P2(1)/n with a = 7.726(1), b = 12.554(2), c = 23.200(6) angstrom, beta = 97.77(2)degrees, V = 2229.56 angstrom-3, D(calcd) = 1.50 g/cm3 and Z = 4. The t-BuCp ring centroids, the chlorine atom and the oxygen atom of the THF describe a distorted tetrahedron around the central ion of ytterbium.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The rare earth monophthalocyanine complexes, LnPcCl and LnPc(OAc)2 (Ln = Tb, Ho, Tm, Lu, Pc=Phthalocyanine, OAc = Acetate), were synthesized. The electronic structures of the complexes have been studied by means of XPS. The experimental results of binding energies for the complexes indicate that the bonds of the complexes have a certain covalent character depending on L-->Ln charge transfer. This L-->Ln charge transfer process of phythalocyanine complexes differs from that of crown ether complexes. Both coordination and substitution are included in the former case, but only coordination in the latter. Phthalocyanine ring is an electrophilic group and its electronegativity is large. So, the O1s binding energies of coordinating oxygen atoms of acetate in LnPc(OAc)2 are larger than those of Ln(OAc)3. The magnitude of valent charge delocalized from ligand onto metal atom is dependent on electronegativity, coordination number, valence state and so on. Because coordination number of Ln in LnPc(OAc)2 is larger than that in LnPcCl and electronegativity of Clin LnPcCl is larger than that of O in LnPc(OAc)2, the Ln4d5/2 binding energies of LnPc (OAc)2 are less than those of LnPcCl.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two different kinds of sensors have been developed by using the same kind of vapochromic complexes. The vapochromic materials [Au2Ag2(C6F5)(4)L-2](n) have different colours depending on the ligand L. These materials change, reversibly, their optical properties, colour and fluorescence, in the presence of the vapours of volatile organic compounds (VOCs). For practical applications, two different ways of fixing the vapochromic material to the optical fibre have been used: the sol-gel technique and the electrostatic self-assembly method (ESA). With the first technique the sensors can even be used to detect VOCs in aqueous solutions, and using the second method it has been possible to develop nanosensors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis focuses on the synthesis and analysis of novel chloride based platinum complexes derived from iminophosphine and phosphinoamide ligands, along with studies on their reactivity towards substitution and oxidation reactions. Also explored here are the potential applications of these complexes for biological and luminescent purposes. Chapter one provides an extensive overview of platinum coordination chemistry with examples of various mixed donor ligands along with the history of platinum anticancer therapy. It also looks at metals in medicine, both for biological functions as well as for therapeutic purposes and gives a background to some other applications for platinum complexes. Chapter two outlines the design and synthetic strategies employed for the development of novel platinum (II) chloride complexes from iminophosphine and phosphinoamide ligands. Also reported is the cyclometallation of these complexes to form stable tridentate mixed donor platinum (II) compounds. In Chapter three the development of a direct method for displacing a chloride from a platinum metal centre with a desired phosphine is reported. Numerous methods for successful oxidation of the platinum (II) complexes will also be explored, leading to novel platinum (IV) complexes being reported here also. The importance of stabilisation of the displaced anion, chloride, by the solvent system will also be discussed in this chapter. Chapter four investigates the reactivity of the platinum (II) complexes towards two different biomolecules to form novel platinum bio-adducts. The potential application of the platinum (II) cyclometallates as chemotherapeutics will also be explored here using in-vitro cancer cell testing. Finally, luminescence studies are also reported here for the ligands and platinum complexes reported in chapter two and three to investigate potential applications in this field also. Chapter five provides a final conclusion and an overall summary of the entire project as well as identifying key areas for future work.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Using quantum chemical calculations, we investigate surface reactions of copper precursors and diethylzinc as the reducing agent for effective Atomic Layer Deposition (ALD) of Cu. The adsorption of various commonly used Cu(II) precursors is explored. The precursors vary in the electronegativity and conjugation of the ligands and flexibility of the whole molecule. Our study shows that the overall stereochemistry of the precursor governs the adsorption onto its surface. Formation of different Cu(II)/Cu(I)/Cu(0) intermediate complexes from the respective Cu(II) compounds on the surface is also explored. The surface model is a (111) facet of a Cu55 cluster. Cu(I) compounds are found to cover the surface after the precursor pulse, irrespective of the precursor chosen. We provide new information about the surface chemistry of Cu(II) versus Cu(I) compounds. A pair of CuEt intermediates or the dimer Cu2Et2 reacts in order to deposit a new Cu atom and release gaseous butane. In this reaction, two electrons from the Et anions are donated to copper for reduction to metallic form. This indicates that a ligand exchange between the Cu and Zn is important for the success of this transmetalation reaction. The effect of the ligands in the precursor on the electron density before and after adsorption onto the surface has also been computed through population analysis. In the Cu(I) intermediate, charge is delocalized between the Cu precursor and the bare copper surface, indicating metallic bonding as the precursor densifies to the surface.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

[Ru(BPY)2POQ-Nmet]2+ and [Ru(TAP)2POQ-Nmet]2+ (1 and 3) are bifunctional complexes composed of a metallic unit linked by a flexible chain to an organic unit. They have been prepared as photoprobes or photoreagents of DNA. In this work, the spectroscopic properties of these bifunctional complexes in the absence of DNA are compared with those of the monofunctional analogues [Ru(BPY)2Phen]2+, [Ru-(BPY)2acPhen]2+, [Ru(TAP)2Phen]2+, and [Ru(TAP)2acPhen]2+ (2 and 4). The electrospray mass spectrometry and absorption data show that the quinoline moiety exists in the protonated and nonprotonated form. Although the bifunctional complex containing 2,2′-bipyridine (BPY) ligands exhibits photophysical properties similar to those of the monofunctional compounds, the bifunctional complex with 1,4,5,8-tetraazaphenanthrene (TAP) ligands behaves quite differently. It has weaker relative emission quantum yields and shorter luminescence lifetimes than the monofunctional TAP analogue when the quinoline unit is nonprotonated. This indicates an efficient intramolecular quenching of the 3MLCT (metal to ligand charge transfer) excited state of the TAP metallic moiety. When the organic unit is protonated, there is no internal quenching. In organic solvent, the nonquenched excited metallic unit (bearing a protonated quinoline) and the quenched one (bearing a nonprotonated organic unit) are in slow equilibrium as compared to the lifetime of the two emitters. In aqueous solution this equilibrium is faster and is catalysed by the presence of phosphate buffer. Flash photolysis experiments suggest that the intramolecular quenching process originates from a photoinduced electron transfer from the nonprotonated quinoline to the excited Ru(TAP)2 2+ moiety.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A thorough and detailed study of diastereointerconversion in the chiral platinum complexes [(NUPHOS)Pt{(S)-BINOL}] (3a-e) has been undertaken and compared with the results of a similar study with [(BIPHEP)Pt{(S)-BINOL}]. Rate data revealed that this process obeys first-order relaxation kinetics, and rate constants for conversion of the minor to the major diastereoisomer have been obtained. Eyring analysis of the data gave DeltaH(double dagger) and DeltaS(double dagger) values of 22-25 kcal mol(-1) and -1 to -16 eu, respectively. In combination with computational analysis, these studies indicate that atropinversion most likely occurs via an on-metal pathway involving a planar seven-membered transition state. Substitution of (S)-BINOL for (S,S)-DPEN results in a marked reduction in the barrier to atropinversion; a DeltaH(double dagger) value of 17 kcal mol(-1) has been determined for the conversion of delta-[(Ph-4-NUPHOS)Pt{(S,S)-DPEN}]Cl-2 to lambda-[(Ph-4-NUPHOS)Pt{(S,S)-DPEN}]Cl-2, which could indicate that an alternative mechanism operates.