1000 resultados para Microscopia de vídeo Teses
Resumo:
Knowing the importance that the poultry industry represents for the Brazilian economy, this work, searched to understand and to identify new welfare pointers inherent to the animal that contributed for the increase of the productive effectiveness, studying different behavior reactions in broiler breeders, in climatic chamber. The experiment was delineated as a Latin Square 3x3x3, where the variable: temperature of air, birds ration and birds age had been controlled. The birds of different ages had been lodged in distinct boxes. Observations of the behavior of the birds in two schedules of the day had been made, being one in the morning and the other one in the afternoon, during a period of 15 minutes each through video cameras, installed in the ceiling of the climatic chamber, having no interference of human being in the register of the data. It was verified the influence of the controlled variables in diverse observed behaviors where it was concluded that the presence of food resulted in bigger occurrences of aggressiveness reactions.
Resumo:
The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.
Resumo:
Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.
Resumo:
Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.
Resumo:
This research intended to investigate the use of diazepam in conjunction with behavioral strategies to manage uncooperative behavior of child dental patients. The 6 participants received dental treatment during 9 sessions. Using a double-blind design, children received placebo or diazepam and at the same time were submitted to behavior management produces (distraction, explanation, reinforcement and set rule and limits). All sessions were recorded in video-tapes biped in 15 seconds intervals, in which observers recorded child's (crying, body and/or head movements, escape and avoidance) and dentist's behavior. The results indicated that diazepam, considering the used dose, was only effective with one subject. The other participants didn't permit the treatment and showed an increase in their resistance. The behavioral preparation strategies for dental treatment should have been more precisely planned in order to help the child to face the real dental treatment conditions mainly in the first sessions avoiding to reinforce inappropriate behaviors.
Resumo:
The present investigation evaluated the effects of diazepam used to manage uncooperative behavior of child dental patients. Six participants received placebo or diazepam (0,3 mg/kg weight) before formal dental treatment at total 54 sessions that were all recorded in videotapes. The analysis of recorded child (crying, body and/or head movements, escape and avoidance) and dentist's behavior management procedures (distraction, explanation, positive reinforcement) indicates no differences by using a double-blind Wilcoxon design (p>0.05). It is suggested the necessity of methodological refinement in studies that combine psychological and pharmacological handling strategies.
Resumo:
The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.
Resumo:
It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Neuronal ceroid-lipofuscinosis (NCL) is a recent term, proposed for acurate designation of the late-onset types of Amaurotic Family Idiocy (AFI). Histopathology shows ubiquitous intraneuronal accumulation of lipopigments, being the most important factor for characterization of the entity at present time. Biochemical changes and pathogenesis are obscure. NCL is in contrast to the infantile type of AFI (Tay-Sachs disease), in which intraneuronal accumulation of gangliosides (sphingolipids) is due to the well known deficiency of a lysosomal enzyme. The authors report on four cases of NCL, two brothers of the late infantile (Jansky-Bielschowsky) type and a brother and a sister of the juvenile (Spielmeyer-Sjögren) type. One autopsy and three cortical biopsies revealed moderate to severe distention of the neurons by lipopigment, with nerve cell loss, gliosis and cerebral atrophy. Lipopigment was also increased in liver, heart and spleen. The patients were the first in Brazilian literature in whom the storage material was identified as lipopigment by histochemical methods. A brief summary of the clinical features of NCL is presented, and relevant problems are discussed, concerning interpretation of the nature of the storage material, and significance of the disease for gerontological research.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação FÃsica