958 resultados para MICROBIAL UREASES
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: This study evaluated the efficacy of NitrAdineTM-based disinfecting cleaning tablets for complete denture, in terms of denture biofilm removal and antimicrobial action. MATERIAL AND METHODS: Forty complete denture wearers (14 men and 26 women) with a mean age of 62.3±9.0 years were randomly assigned to two groups and were instructed to clean their dentures according to two methods: brushing (control) - 3 times a day with denture brush and tap water following meals; brushing and immersion (Experimental) - brushing the denture 3 times a day with denture brush and tap water following meals and immersion of the denture in NitrAdineTM-based denture tablets (Medical InterporousTM). Each method was used for 21 days. Denture biofilm was disclosed by a 1% neutral red solution and quantified by means of digital photos taken from the internal surface before and after the use of the product. Microbiological assessment was conducted to quantify Candida sp. RESULTS: An independent t-test revealed a significant lower biofilm percentage for the experimental group (4.7, 95% CI 2.4 to 7.9) in comparison with the control group (mean 37.5, 95% CI 28.2 to 48.1) (t38=7.996, p<0.001). A significant reduction of yeast colony forming units could be found after treatment with Medical InterporousTM denture tablets as compared to the control group (Mann-Whitney test, Z=1.90; p<0.05). CONCLUSION: The present findings suggest that NitrAdineTM-based disinfecting cleaning tablets are efficient in removal of denture biofilm. In addition, a clear antimicrobial action was demonstrated. Therefore, they should be recommended as a routine denture maintenance method for the prevention of the development of microbial biofilm induced denture stomatitis.
Resumo:
Prosthetic restorations that have been tried in the patient's mouth are potential sources of infection. In order to avoid cross-infection, protocols for infection control should be established in dental office and laboratory. This study evaluated the antimicrobial efficacy of disinfectants on full metal crowns contaminated with microorganisms. Full crowns cast in a Ni-Cr alloy were assigned to one control group (n=6) and 5 experimental groups (n=18). The crowns were placed in flat-bottom glass balloons and were autoclaved. A microbial suspension of each type of strain - S. aureus, P. aeruginosa, S. mutans, E. faecalis and C. albicans- was aseptically added to each experimental group, the crowns being allowed for contamination during 30 min. The contaminated specimens were placed into recipients with the chemical disinfectants (1% and 2% sodium hypochlorite and 2% glutaraldehyde) for 5, 10 and 15 min. Thereafter, the crowns were placed into tubes containing different broths and incubated at 35ºC. The control specimens were contaminated, immersed in distilled water for 20 min and cultured in Thioglycollate broth at 35ºC. Microbial growth assay was performed by qualitative visual examination after 48 h, 7 and 12 days. Microbial growth was noticed only in the control group. In the experimental groups, turbidity of the broths was not observed, regardless of the strains and immersion intervals, thus indicating absence of microbial growth. In conclusion, all chemical disinfectants were effective in preventing microbial growth onto full metal crowns.
Resumo:
A wide variety of opportunistic pathogens has been detected in the tubing supplying water to odontological equipment, in special in the biofilm lining of these tubes. Among these pathogens, Pseudomonas aeruginosa, one of the leading causes of nosocomial infections, is frequently found in water lines supplying dental units. In the present work, 160 samples of water, and 200 fomite samples from forty dental units were collected in the city of Barretos, State of São Paulo, Brazil and evaluated between January and July, 2005. Seventy-six P. aeruginosa strains, isolated from the dental environment (5 strains) and water system (71 strains), were tested for susceptibility to six antimicrobial drugs most frequently used against P. aeruginosa infections. Susceptibility to ciprofloxacin, followed by meropenem was the predominant profile. The need for effective means of reducing the microbial burden within dental unit water lines is emphasized, and the risk of exposure and cross-infection in dental practice, in special when caused by opportunistic pathogens like P. aeruginosa, are highlighted.
Resumo:
OBJECTIVE: The aim of the present study was to determine the in vitro maximum inhibitory dilution (MID) of two chlorhexidinebased oral mouthwashes (CHX): Noplak®, Periogard®, and one polyhexamethylene biguanide-based mouthwash (PHMB): Sanifill Premium® against 28 field Staphylococcus aureus strains using the agar dilution method. MATERIALS AND METHODS: For each product, decimal dilutions ranging from 1/10 to 1/655,360 were prepared in distilled water and added to Mueller Hinton Agar culture medium. After homogenization, the culture medium was poured onto Petri dishes. Strains were inoculated using a Steers multipoint inoculator and dishes were incubated at 37ºC for 24hours. For reading, MID was considered as the maximum dilution of the mouthwash still capable of inhibiting microbial growth. RESULTS: Sanifill Premium® inhibited the growth of all strains at 1/40 dilution and of 1 strain at 1/80 dilution. Noplak® inhibited the growth of 23 strains at 1/640 dilution and of all 28 strains at 1/320 dilution. Periogard® showed inhibited growth of 7 strains at 1/640 dilution and of all 28 strains at 1/320 dilution. Data were submitted to Kruskal-Wallis statistical test, showing significant differences between the mouthwashes evaluated (p<0.05). No significant difference was found between Noplak® and Periogard® (p>0.05). Sanifill Premium® was the least effective (p<0.05). CONCLUSION: It was concluded that CHX-based mouthwashes present better antimicrobial activity against S. Aureus than the PHMB-based mouthwash.
Resumo:
The aim of this in vitro study was to determine the maximum inhibitory dilution (MID) of four cetylpyridinium chloride (CPC)-based mouthwashes: CPC+Propolis, CPC+Malva, CPC+Eucaliptol+Juá+Romã+Propolis (Natural Honey®) and CPC (Cepacol®), against 28 Staphylococcus aureus field strains, using the agar dilution method. Decimal dilutions ranging from 1/10 to 1/655,360 were prepared and added to Mueller Hinton Agar. Strains were inoculated using Steers multipoint inoculator. The inocula were seeded onto the surface of the culture medium in Petri dishes containing different dilutions of the mouthwashes. The dishes were incubated at 37ºC for 24 h. For readings, the MID was considered as the maximum dilution of mouthwash still capable of inhibiting microbial growth. The obtained data showed that CPC+Propolis had antimicrobial activity against 27 strains at 1/320 dilution and against all 28 strains at 1/160 dilution, CPC+Malva inhibited the growth of all 28 strains at 1/320 dilution, CPC+Eucaliptol+Juá+Romã+Propolis inhibited the growth of 2 strains at 1/640 dilution and all 28 strains at 1/320 dilution, and Cepacol® showed antimicrobial activity against 3 strains at 1/320 dilution and against all 28 strains at 1/160 dilution. Data were submitted to Kruskal-Wallis test, showing that the MID of Cepacol® was lower than that determined for the other products (p<0.05). In conclusion, CPC-mouthwashes showed antimicrobial activity against S. aureus and the addition of other substances to CPC improved its antimicrobial effect.
Resumo:
To evaluate the effects of the supplementation of feed additives on carcass quality in beef cattle, 72 Nellore steers (339.5kg, 20-month old) were feedlot finished and fed for 91 days one of the following diets: 1) control with no additives; or added of 2) live yeast culture; 3) monensin; or 4) the association of both additives. After slaughter, renal, pelvic, and inguinal fat and hot carcass weights were recorded and carcass was split into muscle, bone, and trimmable fat. Carcass Longissimus muscle area and subcutaneous fat thickness at the 12th rib were measured and steaks of Longisimus muscle were taken to determine meat color, shear force, drip, and cooking losses. Yeast increased carcass dressing percentage but there were no effects on hot carcass weight, Longissimus area, subcutaneous fat thickness, percentage and weight of retail cut yield and trimmings. Feed additives had no effect on carcass pH, meat color, fat content, shear force, and drip losses. Supplementation of yeast, monensin or the association of both additives had no important effects on carcass traits and on meat quality of feedlot finished steers.
Resumo:
The resistance of pathogens to commonly used antibiotics has enhanced morbidity and mortality and has triggered the search for new drugs. Several species of the red alga genus Laurencia are very interesting candidates as potential sources of natural products with pharmaceutical activity because they are known to produce a wide range of chemically interesting halogenated secondary metabolites. This is an initial report of the antifungal activities of the secondary metabolites of five species of Laurencia, collected in the state of Espírito Santo, against three strains of pathogenic fungi: Candida albicans (CA), Candida parapsilosis (CP), and Cryptococcus neoformans (CN). Minimum inhibitory concentrations (MIC) of the algal extracts were determined by serial dilution method in RPMI 1640 Medium in 96-well plates according to the NCCLS and microbial growth was determined by absorbance at 492nm. A result showing maintenance or reduction of the inoculum was defined as fungistatic, while fungicidal action was no observed growth in the 10 µL fungistatic samples subcultured in Sabouraud Agar. Our results indicate that apolar extracts of Laurencia species possess antifungal properties and encourage continued research to find new drugs for therapy of infectious diseases in these algae.
Resumo:
In this work, different reactions in vitro between an environmental bacterial isolate and fungal species were related. The Gram-positive bacteria had terminal and subterminal endospores, presented metabolic characteristics of mesophilic and acidophilic growth, halotolerance, positive to nitrate reduction and enzyme production, as caseinase and catalase. The analysis of partial sequences containing 400 to 700 bases of the 16S ribosomal RNA gene showed identity with the genus Bacillus. However, its identity as B. subtilis was confirmed after analyses of the rpoB, gyrA, and 16S rRNA near-full-length sequences. Strong inhibitory activity of environmental microorganisms, such as Penicillium sp, Aspergillus flavus, A. niger, and phytopathogens, such as Colletotrichum sp, Alternaria alternata, Fusarium solani and F. oxysporum f.sp vasinfectum, was shown on co-cultures with B. subtilis strain, particularly on Sabouraud dextrose agar (SDA) and DNase media. Red and red-ochre color pigments, probably phaeomelanins, were secreted by A. alternata and A. niger respectively after seven days of co-culture.
Resumo:
Background: In spite of its advantageous physiological properties for bioprocess applications, the use of the yeast Kluyveromyces marxianus as a host for heterologous protein production has been very limited, in constrast to its close relative Kluyveromyces lactis. In the present work, the model protein glucose oxidase (GOX) from Aspergillus niger was cloned into K. marxianus CBS 6556 and into K. lactis CBS 2359 using three different expression systems. We aimed at verifying how each expression system would affect protein expression, secretion/localization, post-translational modification, and biochemical properties. Results: The highest GOX expression levels (1552 units of secreted protein per gram dry cell weight) were achieved using an episomal system, in which the INU1 promoter and terminator were used to drive heterologous gene expression, together with the INU1 prepro sequence, which was employed to drive secretion of the enzyme. In all cases, GOX was mainly secreted, remaining either in the periplasmic space or in the culture supernatant. Whereas the use of genetic elements from Saccharomyces cerevisiae to drive heterologous protein expression led to higher expression levels in K. lactis than in K. marxianus, the use of INU1 genetic elements clearly led to the opposite result. The biochemical characterization of GOX confirmed the correct expression of the protein and showed that K. marxianus has a tendency to hyperglycosylate the protein, in a similar way as already observed for other yeasts, although this tendency seems to be smaller than the one of e. g. K. lactis and S. cerevisiae. Hyperglycosylation of GOX does not seem to affect its affinity for the substrate, nor its activity. Conclusions: Taken together, our results indicate that K. marxianus is indeed a good host for the expression of heterologous proteins, not only for its physiological properties, but also because it correctly secretes and folds these proteins.
Resumo:
The goal of the study was to evaluate the ability of filamentous fungi to biotransform the pentacyclic triterpene lupeol. The microbial transformations were carried out in shake flasks in different media. Experiments were also run with control flasks. Samples of each culture were taken every 24 hours, extracted with ethyl acetate, and analyzed by GC-MS. The biotransformation of lupeol by Aspergillus ochraceus and Mucor rouxii afforded two compounds in each culture, which were detected in the cultures developed for more than seven days only in the Koch's K1 medium. The obtained data demonstrated that A. ochraceus is a good biocatalyst to introduce double bonds in the lupeol structure, whereas M. rouxii exhibits ability to biocatalyze oxygen insertions in that pentacyclic triterpene. Mass spectrometry was demonstrated to be an efficient analytical method to select promising biocatalysts for the compound investigated in this study. The biotransformation processes were influenced by the culture medium and incubation period. The obtained results open the perspective of using A. ochraceus and M. rouxii in pentacyclic triterpene biotransformations.
Resumo:
This study proposes a simplified mathematical model to describe the processes occurring in an anaerobic sequencing batch biofilm reactor (ASBBR) treating lipid-rich wastewater. The reactor, subjected to rising organic loading rates, contained biomass immobilized cubic polyurethane foam matrices, and was operated at 32 degrees C +/- 2 degrees C, using 24-h batch cycles. In the adaptation period, the reactor was fed with synthetic substrate for 46 days and was operated without agitation. Whereas agitation was raised to 500 rpm, the organic loading rate (OLR) rose from 0.3 g chemical oxygen demand (COD) . L(-1) . day(-1) to 1.2 g COD . L(-1) . day(-1). The ASBBR was fed fat-rich wastewater (dairy wastewater), in an operation period lasting for 116 days, during which four operational conditions (OCs) were tested: 1.1 +/- 0.2 g COD . L(-1) . day(-1) (OC1), 4.5 +/- 0.4 g COD . L(-1) . day(-1) (OC2), 8.0 +/- 0.8 g COD . L(-1) . day(-1) (OC3), and 12.1 +/- 2.4 g COD . L(-1) . day(-1) (OC4). The bicarbonate alkalinity (BA)/COD supplementation ratio was 1:1 at OC1, 1:2 at OC2, and 1:3 at OC3 and OC4. Total COD removal efficiencies were higher than 90%, with a constant production of bicarbonate alkalinity, in all OCs tested. After the process reached stability, temporal profiles of substrate consumption were obtained. Based on these experimental data a simplified first-order model was fit, making possible the inference of kinetic parameters. A simplified mathematical model correlating soluble COD with volatile fatty acids (VFA) was also proposed, and through it the consumption rates of intermediate products as propionic and acetic acid were inferred. Results showed that the microbial consortium worked properly and high efficiencies were obtained, even with high initial substrate concentrations, which led to the accumulation of intermediate metabolites and caused low specific consumption rates.
Resumo:
The taxonomic identity in microbial eukaryotes remains an impediment to discussing ecology, biogeography and phylogeny, mainly due to a lack of standards in organism descriptions and few comparative works. The lobose testate amoebae (Arcellinida) present an ideal study system, as progress is severely hindered due to taxonomic confusion. In the present survey, we have examined the morphology, biometry and ecology of 2400 individuals in the genus Arcella Ehrenberg, 1832, collected from the Tiete River in Sao Paulo, Brazil. We then contrasted these new data with 26 previously described species, varieties and forms, looking for consistencies and trying to establish distinct entities. Using a combination of morphology and multivariate statistics we were able to determine 4 distinct taxa (Arcella hemisphaerica, Arcella discoides, Arcella gibbosa and Arcella brasiliensis), each of them encompassing a number of other non-distinct nominal taxa. We describe in detail each of the 4 taxa with notes on ecology and biogeography, and list the indistinguishable names in an effort to make identification and taxonomy in the testate amoebae a more objective and precise exercise by clarifying the taxonomic identity.
Resumo:
The aim of this study was to investigate the presence and prevalence of bla(TEM), bla(SHV), and bla(CTX-M) and bla(GES)-like genes, responsible for extended spectrum beta-lactamases (ESBLs) production in clinical isolates of Klebsiella pneumoniae collected from a Brazilian tertiary care hospital. Sixty-five ESBL producing K. pneumoniae isolates, collected between 2005 and 2007, were screened by polymerase chain reaction (PCR). Identification of bla genes was achieved by sequencing. Genotyping of ESBL producing K. pneumoniae was performed by the enterobacterial repetitive intergenic consensus-PCR with cluster analysis by the Dice coefficient. The presence of genes encoding ESBLs was confirmed in 59/65 (90.8%) isolates, comprising 20 bla(CTX-M-2), 14 bla(CTX-M-59), 12 bla(CTX-M-15), 9 bla(SHV-12), 1 bla(SHV-2), 1 bla(SHV-2a), 1 bla(SHV-5), and 1 bla(SHV-31) genes. The ESBL genes bla(SHV-12), bla(SHV-31), and bla(CTX-M-15), and the chromosome-encoded SHV-type beta-lactamase capable of hydrolyzing imipenem were detected in Brazil for the first time. The analysis of the enterobacterial repetitive intergenic consensus-PCR band patterns revealed a high rate of multiclonal bla(CTX-M) carrying K. pneumoniae isolates (70.8%), suggesting that dissemination of encoding plasmids is likely to be the major cause of the high prevalence of these genes among the K. pneumoniae isolates considered in this study.
Resumo:
Background: The malaria parasite Plasmodium falciparum exhibits abundant genetic diversity, and this diversity is key to its success as a pathogen. Previous efforts to study genetic diversity in P. falciparum have begun to elucidate the demographic history of the species, as well as patterns of population structure and patterns of linkage disequilibrium within its genome. Such studies will be greatly enhanced by new genomic tools and recent large-scale efforts to map genomic variation. To that end, we have developed a high throughput single nucleotide polymorphism (SNP) genotyping platform for P. falciparum. Results: Using an Affymetrix 3,000 SNP assay array, we found roughly half the assays (1,638) yielded high quality, 100% accurate genotyping calls for both major and minor SNP alleles. Genotype data from 76 global isolates confirm significant genetic differentiation among continental populations and varying levels of SNP diversity and linkage disequilibrium according to geographic location and local epidemiological factors. We further discovered that nonsynonymous and silent (synonymous or noncoding) SNPs differ with respect to within-population diversity, interpopulation differentiation, and the degree to which allele frequencies are correlated between populations. Conclusions: The distinct population profile of nonsynonymous variants indicates that natural selection has a significant influence on genomic diversity in P. falciparum, and that many of these changes may reflect functional variants deserving of follow-up study. Our analysis demonstrates the potential for new high-throughput genotyping technologies to enhance studies of population structure, natural selection, and ultimately enable genome-wide association studies in P. falciparum to find genes underlying key phenotypic traits.