882 resultados para Large-Scale Optimization


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Metal oxide protection layers for photoanodes may enable the development of large-scale solar fuel and solar chemical synthesis, but the poor photovoltages often reported so far will severely limit their performance. Here we report a novel observation of photovoltage loss associated with a charge extraction barrier imposed by the protection layer, and, by eliminating it, achieve photovoltages as high as 630mV, the maximum reported so far for water-splitting silicon photoanodes. The loss mechanism is systematically probed in metal-insulator-semiconductor Schottky junction cells compared to buried junction p(+) n cells, revealing the need to maintain a characteristic hole density at the semiconductor/insulator interface. A leaky-capacitor model related to the dielectric properties of the protective oxide explains this loss, achieving excellent agreement with the data. From these findings, we formulate design principles for simultaneous optimization of built-in field, interface quality, and hole extraction to maximize the photovoltage of oxide-protected water-splitting anodes.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Abstract : Although concrete is a relatively green material, the astronomical volume of concrete produced worldwide annually places the concrete construction sector among the noticeable contributors to the global warming. The most polluting constituent of concrete is cement due to its production process which releases, on average, 0.83 kg CO[subscript 2] per kg of cement. Self-consolidating concrete (SCC), a type of concrete that can fill in the formwork without external vibration, is a technology that can offer a solution to the sustainability issues of concrete industry. However, all of the workability requirements of SCC originate from a higher powder content (compared to conventional concrete) which can increase both the cost of construction and the environmental impact of SCC for some applications. Ecological SCC, Eco-SCC, is a recent development combing the advantages of SCC and a significantly lower powder content. The maximum powder content of this concrete, intended for building and commercial construction, is limited to 315 kg/m[superscript 3]. Nevertheless, designing Eco-SCC can be challenging since a delicate balance between different ingredients of this concrete is required to secure a satisfactory mixture. In this Ph.D. program, the principal objective is to develop a systematic design method to produce Eco-SCC. Since the particle lattice effect (PLE) is a key parameter to design stable Eco-SCC mixtures and is not well understood, in the first phase of this research, this phenomenon is studied. The focus in this phase is on the effect of particle-size distribution (PSD) on the PLE and stability of model mixtures as well as SCC. In the second phase, the design protocol is developed, and the properties of obtained Eco-SCC mixtures in both fresh and hardened states are evaluated. Since the assessment of robustness is crucial for successful production of concrete on large-scale, in the final phase of this work, the robustness of one the best-performing mixtures of Phase II is examined. It was found that increasing the volume fraction of a stable size-class results in an increase in the stability of that class, which in turn contributes to a higher PLE of the granular skeleton and better stability of the system. It was shown that a continuous PSD in which the volume fraction of each size class is larger than the consecutive coarser class can increase the PLE. Using such PSD was shown to allow for a substantial increase in the fluidity of SCC mixture without compromising the segregation resistance. An index to predict the segregation potential of a suspension of particles in a yield stress fluid was proposed. In the second phase of the dissertation, a five-step design method for Eco-SCC was established. The design protocol started with the determination of powder and water contents followed by the optimization of sand and coarse aggregate volume fractions according to an ideal PSD model (Funk and Dinger). The powder composition was optimized in the third step to minimize the water demand while securing adequate performance in the hardened state. The superplasticizer (SP) content of the mixtures was determined in next step. The last step dealt with the assessment of the global warming potential of the formulated Eco-SCC mixtures. The optimized Eco-SCC mixtures met all the requirements of self-consolidation in the fresh state. The 28-day compressive strength of such mixtures complied with the target range of 25 to 35 MPa. In addition, the mixtures showed sufficient performance in terms of drying shrinkage, electrical resistivity, and frost durability for the intended applications. The eco-performance of the developed mixtures was satisfactory as well. It was demonstrated in the last phase that the robustness of Eco-SCC is generally good with regards to water content variations and coarse aggregate characteristics alterations. Special attention must be paid to the dosage of SP during batching.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

A landing obligation was formally implemented in the European Union (EU) for the first time, as part of the recent reform of the EU Common Fisheries Policy (CFP). Given the reasonable success of the landing obligation in some countries such as the Faroe Islands, Iceland and Norway, this policy is seen as a viable approach to tackle the long-recognized discarding problem in EU waters. However, there has been some debate on whether there is sufficient evidence to support the feasibility of such a measure in the EU-CFP. The EU landing obligation will implicitly include all small-scale fisheries (SSF) provided the species captured are subject to catch limits or minimum sizes (in the case of the Mediterranean). SSF were included irrespective of the fact that the discarding problem in the EU has been historically associated with medium- to large-scale fleets (in particular largely mixed species trawl fisheries). Additionally, past experiences with a discard ban policy are still limited to specific countries and/or specific fisheries. This paper examined the appropriateness and feasibility of the recently implemented EU landing obligation in SSF. The effects in the long-term are unpredictable, but available evidence suggests that in the short to medium-term a landing obligation is likely to bring more negative social, economic and ecological impacts than benefits. (C) 2015 Elsevier Ltd. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Canopy and aerodynamic conductances (gC and gA) are two of the key land surface biophysical variables that control the land surface response of land surface schemes in climate models. Their representation is crucial for predicting transpiration (λET) and evaporation (λEE) flux components of the terrestrial latent heat flux (λE), which has important implications for global climate change and water resource management. By physical integration of radiometric surface temperature (TR) into an integrated framework of the Penman?Monteith and Shuttleworth?Wallace models, we present a novel approach to directly quantify the canopy-scale biophysical controls on λET and λEE over multiple plant functional types (PFTs) in the Amazon Basin. Combining data from six LBA (Large-scale Biosphere-Atmosphere Experiment in Amazonia) eddy covariance tower sites and a TR-driven physically based modeling approach, we identified the canopy-scale feedback-response mechanism between gC, λET, and atmospheric vapor pressure deficit (DA), without using any leaf-scale empirical parameterizations for the modeling. The TR-based model shows minor biophysical control on λET during the wet (rainy) seasons where λET becomes predominantly radiation driven and net radiation (RN) determines 75 to 80 % of the variances of λET. However, biophysical control on λET is dramatically increased during the dry seasons, and particularly the 2005 drought year, explaining 50 to 65 % of the variances of λET, and indicates λET to be substantially soil moisture driven during the rainfall deficit phase. Despite substantial differences in gA between forests and pastures, very similar canopy?atmosphere "coupling" was found in these two biomes due to soil moisture-induced decrease in gC in the pasture. This revealed the pragmatic aspect of the TR-driven model behavior that exhibits a high sensitivity of gC to per unit change in wetness as opposed to gA that is marginally sensitive to surface wetness variability. Our results reveal the occurrence of a significant hysteresis between λET and gC during the dry season for the pasture sites, which is attributed to relatively low soil water availability as compared to the rainforests, likely due to differences in rooting depth between the two systems. Evaporation was significantly influenced by gA for all the PFTs and across all wetness conditions. Our analytical framework logically captures the responses of gC and gA to changes in atmospheric radiation, DA, and surface radiometric temperature, and thus appears to be promising for the improvement of existing land?surface?atmosphere exchange parameterizations across a range of spatial scales.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Canopy and aerodynamic conductances (gC and gA) are two of the key land surface biophysical variables that control the land surface response of land surface schemes in climate models. Their representation is crucial for predicting transpiration (?ET) and evaporation (?EE) flux components of the terrestrial latent heat flux (?E), which has important implications for global climate change and water resource management. By physical integration of radiometric surface temperature (TR) into an integrated framework of the Penman?Monteith and Shuttleworth?Wallace models, we present a novel approach to directly quantify the canopy-scale biophysical controls on ?ET and ?EE over multiple plant functional types (PFTs) in the Amazon Basin. Combining data from six LBA (Large-scale Biosphere-Atmosphere Experiment in Amazonia) eddy covariance tower sites and a TR-driven physically based modeling approach, we identified the canopy-scale feedback-response mechanism between gC, ?ET, and atmospheric vapor pressure deficit (DA), without using any leaf-scale empirical parameterizations for the modeling. The TR-based model shows minor biophysical control on ?ET during the wet (rainy) seasons where ?ET becomes predominantly radiation driven and net radiation (RN) determines 75 to 80?% of the variances of ?ET. However, biophysical control on ?ET is dramatically increased during the dry seasons, and particularly the 2005 drought year, explaining 50 to 65?% of the variances of ?ET, and indicates ?ET to be substantially soil moisture driven during the rainfall deficit phase. Despite substantial differences in gA between forests and pastures, very similar canopy?atmosphere "coupling" was found in these two biomes due to soil moisture-induced decrease in gC in the pasture. This revealed the pragmatic aspect of the TR-driven model behavior that exhibits a high sensitivity of gC to per unit change in wetness as opposed to gA that is marginally sensitive to surface wetness variability. Our results reveal the occurrence of a significant hysteresis between ?ET and gC during the dry season for the pasture sites, which is attributed to relatively low soil water availability as compared to the rainforests, likely due to differences in rooting depth between the two systems. Evaporation was significantly influenced by gA for all the PFTs and across all wetness conditions. Our analytical framework logically captures the responses of gC and gA to changes in atmospheric radiation, DA, and surface radiometric temperature, and thus appears to be promising for the improvement of existing land?surface?atmosphere exchange parameterizations across a range of spatial scales.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

In this thesis, a tube-based Distributed Economic Predictive Control (DEPC) scheme is presented for a group of dynamically coupled linear subsystems. These subsystems are components of a large scale system and control inputs are computed based on optimizing a local economic objective. Each subsystem is interacting with its neighbors by sending its future reference trajectory, at each sampling time. It solves a local optimization problem in parallel, based on the received future reference trajectories of the other subsystems. To ensure recursive feasibility and a performance bound, each subsystem is constrained to not deviate too much from its communicated reference trajectory. This difference between the plan trajectory and the communicated one is interpreted as a disturbance on the local level. Then, to ensure the satisfaction of both state and input constraints, they are tightened by considering explicitly the effect of these local disturbances. The proposed approach averages over all possible disturbances, handles tightened state and input constraints, while satisfies the compatibility constraints to guarantee that the actual trajectory lies within a certain bound in the neighborhood of the reference one. Each subsystem is optimizing a local arbitrary economic objective function in parallel while considering a local terminal constraint to guarantee recursive feasibility. In this framework, economic performance guarantees for a tube-based distributed predictive control (DPC) scheme are developed rigorously. It is presented that the closed-loop nominal subsystem has a robust average performance bound locally which is no worse than that of a local robust steady state. Since a robust algorithm is applying on the states of the real (with disturbances) subsystems, this bound can be interpreted as an average performance result for the real closed-loop system. To this end, we present our outcomes on local and global performance, illustrated by a numerical example.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Abstract In this paper, we address the problem of picking a subset of bids in a general combinatorial auction so as to maximize the overall profit using the first-price model. This winner determination problem assumes that a single bidding round is held to determine both the winners and prices to be paid. We introduce six variants of biased random-key genetic algorithms for this problem. Three of them use a novel initialization technique that makes use of solutions of intermediate linear programming relaxations of an exact mixed integer-linear programming model as initial chromosomes of the population. An experimental evaluation compares the effectiveness of the proposed algorithms with the standard mixed linear integer programming formulation, a specialized exact algorithm, and the best-performing heuristics proposed for this problem. The proposed algorithms are competitive and offer strong results, mainly for large-scale auctions.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

After a long incubation period, the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES) is now underway. Underpinning all its activities is the IPBES Conceptual Framework (CF), a simplified model of the interactions between nature and people. Drawing on the legacy of previous large-scale environmental assessments, the CF goes further in explicitly embracing different disciplines and knowledge systems (including indigenous and local knowledge) in the co-construction of assessments of the state of the world's biodiversity and the benefits it provides to humans. The CF can be thought of as a kind of Rosetta Stone that highlights commonalities between diverse value sets and seeks to facilitate crossdisciplinary and crosscultural understanding. We argue that the CF will contribute to the increasing trend towards interdisciplinarity in understanding and managing the environment. Rather than displacing disciplinary science, however, we believe that the CF will provide new contexts of discovery and policy applications for it.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

O objetivo deste estudo foi avaliar as taxas de mortalidade por câncer de boca no período de 1991-2001, no município de Bauru-SP. A fonte de informação utilizada para o reconhecimento e seleção da população-alvo foram Certidões de Óbito dos Cartórios do município de Bauru com dados relativos ao período 1991-2001. Foram coletadas informações referentes a sexo, idade, localização da lesão e endereço. A coleta dos endereços visou à identificação no mapa do município de Bauru da localização geográfica do domicílio. Utilizando ferramentas do geoprocessamento, foi feita a inserção no mapa dos casos identificados. Foram registrados 67 casos de morte por câncer de boca na cidade de Bauru entre 1991 e 2001, com maiores taxas no sexo masculino e sexta década de vida. A análise da distribuição espacial mostra que a maioria dos casos encontra-se próxima à linha férrea que corta o município e foi responsável, em grande parte, pela ocupação territorial pela população, sendo esta também uma área que abrange os bairros mais antigos do município. O câncer de boca constitui importante causa de óbito no município, requerendo um planejamento de ações georreferenciadas pelo sistema local de saúde.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

É apresentado um estudo sobre sistemas convectivos linearmente organizados e observados por um radar meteorológico banda-C na região semi-árida do Nordeste do Brasil. São analisados três dias (27 a 29) de março de 1985, com ênfase na investigação do papel desempenhado por fatores locais e de grande escala no desenvolvimento dos sistemas. No cenário de grande escala, a área de cobertura do radar foi influenciada por um cavado de ar superior austral no dia 27 e por um vórtice ciclônico de altos níveis no dia 29. A convergência de umidade próxima à superfície favoreceu a atividade convectiva nos dias 27 e 29, enquanto que divergência de umidade próxima à superfície inibiu a atividade convectiva no dia 28. No cenário de mesoescala, foi observado que o aquecimento diurno é um fator importante para a formação de células convectivas, somando-se a ele o papel determinante da orografia na localização dos ecos. De maneira geral, as imagens de radar mostram os sistemas convectivos linearmente organizados em áreas elevadas e núcleos convectivos intensos envolvidos por uma área de precipitação estratiforme. Os resultados indicam que convergência do fluxo de umidade em grande escala e aquecimento radiativo, são fatores determinantes na evolução e desenvolvimento dos ecos na área de estudo.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The South Atlantic Magnetic Anomaly (SAMA) is one of the most outstanding anomalies of the geomagnetic field. The SAMA secular variation was obtained and compared to the evolution of other anomalies using spherical harmonic field models for the 1590-2005 period. An analysis of data from four South American observatories shows how this large scale anomaly affected their measurements. Since SAMA is a low total field anomaly, the field was separated into its nondipolar, quadrupolar and octupolar parts. The time evolution of the non-dipole/total, quadrupolar/total and octupolar/total field ratios yielded increasingly high values for the South Atlantic since 1750. The SAMA evolution is compared to the evolution of other large scale surface geomagnetic features like the North and the South Pole and the Siberia High, and this comparison shows the intensity equilibrium between these anomalies in both hemispheres. The analysis of non-dipole fields in historical period suggests that SAMA is governed by (i) quadrupolar field for drift, and (ii) quadrupolar and octupolar fields for intensity and area of influence. Furthermore, our study reinforces the possibility that SAMA may be related to reverse fluxes in the outer core under the South Atlantic region.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Somatic embryogenesis represents a valuable tool for the studies on the basic aspects of plant embryo development. Today this process is used as a potencial technique for large-scale plant micropropagation although, so far, it has been applied to only a small number of species. However, when somatic embryos are malformed they are considered economically useless. In Acca sellowiana (O. Berg) Burret, an important fruit-producing crop, large amounts of anomalous somatic embryos (76.3%) were found just after 40 days of culture of explants in a 2,4-D containing medium. Among the anomalous forms found in the cotiledonary stage, 12.2% consisted of fused embryos, 40.4% displayed fused cotyledons, 13.0% presented supernumerary cotyledons, and 10.7% showed absence or poorly developed cotyledons, including those without the shoot apical meristem. Histological analyses indicated that the altered embryos were formed either directly from cotyledons, hypocotyl and radicle of the zygotic embryos used as explants, or indirectly from calli formed from these tissue parts. It is suggested that the formation of anomalous somatic embryos, as well as a low frequency of conversion into emblings reflect physiological and/or genetic disturbances triggered by the presence of 2,4-D in the medium. In vitro experimental alternative approaches are discussed in order to lessen the occurrence of malformed somatic embryos.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Non-coding RNAs (ncRNAs) were recently given much higher attention due to technical advances in sequencing which expanded the characterization of transcriptomes in different organisms. ncRNAs have different lengths (22 nt to >1, 000 nt) and mechanisms of action that essentially comprise a sophisticated gene expression regulation network. Recent publication of schistosome genomes and transcriptomes has increased the description and characterization of a large number of parasite genes. Here we review the number of predicted genes and the coverage of genomic bases in face of the public ESTs dataset available, including a critical appraisal of the evidence and characterization of ncRNAs in schistosomes. We show expression data for ncRNAs in Schistosoma mansoni. We analyze three different microarray experiment datasets: (1) adult worms' large-scale expression measurements; (2) differentially expressed S. mansoni genes regulated by a human cytokine (TNF-α) in a parasite culture; and (3) a stage-specific expression of ncRNAs. All these data point to ncRNAs involved in different biological processes and physiological responses that suggest functionality of these new players in the parasite's biology. Exploring this world is a challenge for the scientists under a new molecular perspective of host-parasite interactions and parasite development.