Seed rain in areas with and without bamboo dominance within an urban fragment of the Atlantic Forest

Understanding the flow of diaspores is fundamental for determining plant population dynamics in a particular habitat, and a lack of seeds is a limiting factor in forest regeneration, especially in isolated forest fragments. Bamboo dominance affects forest structure and dynamics by suppressing or delaying the recruitment of and colonization by tree species as well as by inhibiting the survival and growth of adult trees. The goal of the present study was to determine whether dominance of the bamboo species Aulonemia aristulata (Döll) McClure in the forest understory influences species abundance and composition. We examined the seed rain at two noncontiguous sites (1.5 km apart) within an urban forest fragment, with and without bamboo dominance (BD+ and BD- areas, respectively). Sixty seed traps (0.5 m², with a 1-mm mesh) were set in the BD+ and BD- areas, and the seed rain was sampled from January to December 2007. Diaspores were classified according to dispersal syndrome, growth form and functional type of the species to which they belonged. There were significant differences between the two areas in terms of seed density, species diversity and dispersal syndrome. The BD+ area showed greater seed density and species diversity. In both areas, seed distribution was limited primarily by impaired dispersal. Bamboo dominance and low tree density resulted in fewer propagules in the seed rain. Our results suggest that low availability of seeds in the rain does not promote the maintenance of a degraded state, characterized by the presence of bamboo.

Structure of the understory community in four stretches of Araucaria forest in the state of São Paulo, Brazil

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

English and the discourses of colonialism

415

Linearization of Chains and Sideward Movement

360

Performativity and the claims of scientificity of modern linguistics

This paper discusses the claim of the situatedness of research in both theoretical and applied linguistics and some of its implications and argues that it is linked to the performativity of all assertions, including scientific ones. More importantly, I argue that it is the regressive infinity of performativity that makes inevitable the passage from presumably 'dispassionate' research to militancy.

Thermolysed and active yeast to reduce the toxicity of aflatoxin

Aflatoxins are hepatotoxic metabolites produced by Aspergillus flavus and A. parasiticus on a number of agricultural commodities. This research was carried out to evaluate the ability of thermolysed and active Saccharomyces cerevisiae to attenuate liver damage caused by aflatoxin. Diets were prepared containing 0 aflatoxin; 400 mug kg-1 aflatoxin; 400 mug kg-1 aflatoxin plus 1% of dehydrated active yeast, and 400 mug kg-1 aflatoxin plus 1% of thermolysed yeast. A bioassay with Wistar rats was conducted for 28 days, and body organs were weighted and analyses of the liver tissue of the animals were performed. The relative weight of heart, kidneys and liver from animals submitted to the different treatments did not show any difference, and liver tissue of animals feeding on the aflatoxin-free diet was adopted as a toxicity-free pattern. Hepatic tissue of animals feeding on diets containing 400 mug kg-1 aflatoxin or the diet supplemented with 1% thermolysed yeast showed clear signs of toxicity and damage. Hepatic tissue of animals feeding on the diet containing 1% of dehydrated active yeast showed less toxicity signs and damage than those receiving the diet containing 400 mug kg-1 aflatoxin. Active, dehydrated yeast had the ability to reduce toxic effects caused by aflatoxin, but thermolysed yeast was not able to alleviate the effects of aflatoxin toxicity.

Evaluation of the performance of different plastics used to seal nylon cDNA arrays

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Tissue culture of Cecropia glaziovii Sneth (urticaceae): vegetative micropropagation and plant regeneration from callus

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Behaviour of albino and melanic variants of Biomphalaria glabrata Say, 1818 (Mollusca: Planorbidae) following infection by Schistosoma mansoni Sambon, 1907

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) food habits in a mosaic of Atlantic Rainforest and eucalypt plantations of southeastern Brazil

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Rootstocks induce contrasting photosynthetic responses of orange plants to low night temperature without affecting the antioxidant metabolism

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.

Antioxidative responses of cell suspension cultures of two Coffea arabica varieties to low aluminum levels at pH 5.8

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Atypical antipsychotics in the treatment of pathological aggression in children and adolescents: literature review and clinical recommendations

Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.