Production endogène de Nortestostérone chez l'homme et influence de l'activité physique et du régime alimentaire

RESUME Depuis les années 1980, les stéroïdes androgéniques anabolisants (SAA) sont restés les produits dopants les plus utilisés par les sportifs. Les propriétés principales attribuées à ces substances sont une augmentation de la masse et de la force musculaire ainsi qu'une agressivité supérieure pouvant s'avérer bénéfique lors des entraînements ou des compétitions. En plus de cette "tradition" liée à la consommation des SAA, une autre problématique est apparue dans le monde antidopage suite à la fulgurante expansion de l'utilisation des compléments alimentaires par les athlètes professionnels et amateurs. Dès la fin des années 1990, une recrudescence de cas positifs de dopage aux SAA a été attribuée à la contamination des compléments alimentaires par des composés anabolisants tels que la testostérone ou la nandrolone ou par des prohormones se situant en amont dans le métabolisme de certains SAA et conduisant à la présence, dans les urines, de traces de substances interdites par l'Agence Mondiale Antidopage (AMA). Afin de mettre en garde les autorités antidopage ainsi que les athlètes quant aux problèmes liés aux compléments alimentaires, le Laboratoire Suisse d'Analyse du Dopage (LAD) a décidé d'étudier de manière plus précise la composition d'une centaine de produits accessibles en Suisse par l'intermédiaire d'internet. Cette étude a permis de mettre en évidence un taux de non conformité des produits avoisinant les 20%, avec une contamination plus importante des produits contenant des hormones ou des prohormones. La consommation de doses journalières recommandées des produits contaminés a mené à la détection dans les urines de la présence de substances interdites par l'AMA. Ces résultats confirment ainsi que l'usage de compléments alimentaires peut s'avérer dangereuse dans le cadre de contrôles antidopage et que les effets sur l'état physique et mental des athlètes peuvent dépasser les effets désirés et être dramatiques pour la poursuite d'une carrière sportive. D'autre part, cela démontre que l'alimentation peut mener à la présence urinaire de substances proscrites telles que les métabolites de la nandrolone, la 19-norandrostéreone (19-NA) et la 19-norétiocholanolone (19-NE). Afin de démontrer un effet potentiel de l'exercice physique sur l'excrétion urinaire des métabolites de la nandrolone, une première étude clinique a été réalisée avec 34 volontaires. Deux doses orales de nandrolone marquée avec deux atomes de C13 ont été administrées aux sujets. Les urines ont été récoltées durant les 5 jours suivant les prises orales (études d'excrétion) ainsi qu'avant et après les 8 séances d'entraînements du protocole. Les analyses des études d'excrétion ont permis d'établir une variabilité intra- et inter-individuelle du métabolisme et de la pharmacocinétique de la 19-NA et de la 19-NE. En dépit de la rapide élimination urinaire des métabolites de la nandrolone C13, les analyses des échantillons prélevés avant et après les différents efforts n'ont pas révélé une influence nette de l'exercice physique sur les concentrations urinaires de la 19-NA et 19-NE. Une seconde étude clinique a été effectuée, avec la participation de 30 volontaires. Il s'agissait de déterminer si la consommation de multiples doses orales d'un décanoate de testostérone, de 19-norandrostenedione (un précurseur de la nandrolone) ou de placebo durant un mois, pouvait avoir des effets bénéfiques sur la récupération et la performance physique. En parallèle, les sujets étaient soumis à un entrainement d'endurance intense et individualisé. Divers paramètres physiologiques ont été étudiés dans le sérum et les urines afin de mettre en évidence une meilleure récupération de l'organisme. Aucun de ses paramètres n'a permis de conclure que la consommation orale de SAA est favorable pour optimaliser les capacités de récupération des athlètes. De plus, les performances physiques ont été évaluées avant et après l'entraînement et le traitement. Aucune différence significative n'a été démontrée entre les trois groupes de volontaires. L'état psychologique des volontaires a été évalué à l'aide de questionnaires (short Profile of Mood State, sPOMS) remplis à trois reprises au cours du protocole. De manière générale, l'évolution observée est une augmentation de la fatigue avec une diminution de la vigueur. Des analyses statistiques ont révélé que des prises orales de testostérone, et dans une moindre mesure de 19-norandrostenedione, ont une légère influence sur cette évolution générale en diminuant les effets de l'entrainement sur le profil psychologique. Les urines récoltées durant le protocole ont été analysées par GC/C/IRMS et GCMS afin de détecter les variations des concentrations des hormones liées au métabolisme de la testostérone. Les résultats ont démontré une variabilité interindividuelle du métabolisme de la testostérone qui implique que les critères de positivité imposés par l'AMA ne sont pas forcément valables pour tous les individus. La détection de la 19-NA et de la 19-NE, issus du métabolisme in vivo de la 19norandrostenedione, a confirmé les résultats obtenus sur la pharmacocinétique et le métabolisme de la nandrolone C13 obtenus lors de la première étude clinique. Ce travail a permis de clarifier certains points en lien avec l'abus de la nandrolone dans le sport et notamment par rapport à la consommation de compléments alimentaires. Les deux études cliniques n'ont pas véritablement apporté les réponses souhaitées aux hypothèses de départ. Cependant certains aspects intéressants en relation avec le métabolisme des SAA ont été découverts et pourront peut-être permettre à la lutte antidopage d'évoluer vers une meilleure efficacité. SUMMARY Since 1980's, anabolic androgenic steroids (AAS) are still the most used doping agents in sports. The main properties attributed to these substances are an increase of muscle mass and strength and also a higher aggressiveness that could be beneficial during trainings and competitions. In addition to this "tradition" linked to the AAS intake, another problematics has raised in the antidoping field. Indeed, nutritional supplements have been more and more used by professional and amateur athletes. Since the end of the 1990's, an outburst of positive doping cases with AAS has been attributed to nutritional supplements contaminations with anabolic compounds like testosterone or nandrolone or with prohormones located above in the metabolism of some AAS and prompting urinary traces of forbidden compounds by the World Antidoping Agency (WADA). In order to inform the antidoping authorities and the athletes about the problems linked to the nutritional supplements, the Swiss Laboratory for Doping Analyses (LAD) decided to investigate more precisely the composition of about hundred products accessible in Switzerland through different web sites. This study showed that about 20% of the products were not conformed to the composition announced by the manufacturers. The oral intake of daily recommended doses of the contaminated products revealed the presence in urines of forbidden substances by the WADA. Hence, these results confirm that the use of nutritional supplements can lead to adverse analytical findings in antidoping controls and that the effects on athletes' physical and mental state could be different from the ones desired and could be dramatic for the continuation of an athlete's career. Moreover, this demonstrates that the diet can lead to the presence in urines of proscribed substances like nandrolone metabolites, i.e. 19-norandrosterone (19-NA) and 19-noretiocholanolone (19-NE). To put forward a potential effect of physical exercise on urinary nandrolone metabolites excretion rate, a first clinical study was done with 34 volunteers. Two oral doses of nandrolone labelled with two C13 atoms were administered to the subjects. The urines were collected during the 5 days following the treatment (excretion studies) and before and after the 8 exercise sessions of the protocol. The analyses of excretion studies revealed an intra- and inter-individual variability of the metabolism and the pharmacokinetics of 19-NA and 19-NE. In spite of the rapid urinary elimination of the nandrolone C13 metabolites, the analyses of the urine samples gathered before and after efforts did not show a clear influence of physical exercise on the urinary 19-NA and 19-NE concentrations. A second clinical study was done with the participation of 30 volunteers. The main aim was to determine if multiple oral doses of testosterone undecanoate, 19-norandrostenedione (a nandrolone precursor) or placebo during one month, could have beneficial effects on recovery and physical performance. Meanwhile, the individuals had to follow an intense and personalized endurance training program. Several physiological parameters were investigated in serum and urines in order to demonstrate a better organism's recovery. None of these parameters lead to the conclusion that oral intake of AAS is useful to optimise the recovery capacities of athletes. In addition, physical performances were evaluated before and after the training and treatment month. No significant difference was shown between the three volunteers groups. The psychological state of the volunteers was assessed through questionnaires (short Profile of Mood State, sP4MS) filled three times during the protocol. The global evolution is an increase of fatigue with an decrease of vigour. Statistical analyses revealed that the oral intake of testosterone, and to a lesser extent of 19= norandrostenedione, have a small influence on this general evolution in decreasing the effect of training on the psychological profile. The urines collected during the protocol were analysed by GC/C/IRMS and GCMS to detect concentrations variations of hormones related to the testosterone metabolism. The results revealed an interindividual variability of testosterone metabolism which implies that the guidance concerning endogenous steroids prescribed by the WADA are not uniformly valid for all individuals. Detection of 19-NA and 19-NE, coming from the in vivo metabolism of 19norandrostenedione, confirmed the results previously obtained on the pharamcokinetics and metabolism of the nandrolone C13 in the first clinical study. This work allowed to clarify some aspects linked to nandrolone abuse in sports and noteworthy related to nutritional supplements intake. The two clinical studies did not really bring plain answers to the basal hypotheses but some interesting aspects in relation with AAS metabolism were put forth and would perhaps allow an evolution of a more effective fight against doping.

Gestão do conhecimento em uma estrutura organizacional em rede

As relações de parceria são cada vez mais comuns entre as organizações, criando estruturas de relações em rede. E uma importante tarefa que emerge nas empresas prestadoras de serviço é a gestão do conhecimento, visando a melhorar seus processos. O objetivo deste artigo é analisar como os aspectos organizacionais, de ordem técnica e social, de uma estrutura organizacional em rede facilitam a gestão do conhecimento a fim de promover atividades de melhoria contínua. A empresa pesquisada, uma prestadora de serviços industriais, implementou uma estrutura de sites full service, responsáveis por atividades de rotina e de melhoria, em tempo integral, nos clientes, além de centros de excelência, que promovem o processo de gestão do conhecimento (GC). Para alcançar este objetivo, foi realizada uma pesquisa qualitativa, baseada em estudo de caso exploratório. O resultado da pesquisa aponta que o fluxo de conhecimento entre os indivíduos e entre os diversos sites é intensificado devido às interações em rede, aumentando o potencial da organização em promover melhorias.

Inteligência competitiva e suas conexões epistemológicas com gestão da informação e do conhecimento

O artigo apresenta uma revisão de literatura mostrando o estado-da-arte conceitual na disciplina corporativa denominada inteligência competitiva (IC), sob um ponto de vista da ciência da informação (CI), explorando desenvolvimentos e experiências recentes. Embora já presente nas sociedades da Antiguidade, objeto de estudo de soberanos, pensadores e guerreiros, a inteligência competitiva (IC), inspirada nas atividades de inteligência militar, constitui tema bastante atual no mundo corporativo contemporâneo de competição global, com renovado interesse no mercado e na academia. Como o tema apresenta evidentes conexões epistemológicas com gestão da informação (GI) e gestão do conhecimento (GC), o texto busca mostrar como isso ocorre e as relações de causa e efeito entre as várias camadas de atividades vinculadas ao desenvolvimento de inteligência para tomada de decisão nas organizações inspirado no framework de Liebowitz (2006) baseado numa estrutura de cebola. Conceitos correlatos são também explorados, como o próprio conceito de GC, numa praxis composta de disciplinas corporativas conhecidas como aprendizado organizacional, gestão do capital intelectual ou capital humano e inteligência organizacional. Conceitos novos correlatos à inteligência competitiva são acrescentados ao conjunto intelligentsia galore de Liebowitz (2006), como capital estrutural, capital de clientela, capital competitivo e inteligência estratégica (IE).

Determinants of the omega-3 index in a Mediterranean population at increased risk for CHD.

The omega-3 index, defined as the sum of EPA and DHA in erythrocyte membranes expressed as a percentage of total fatty acids, has been proposed as both a risk marker and risk factor for CHD death. A major determinant of the omega-3 index is EPA þ DHA intake, but the impact of other dietary fatty acids has not been investigated. In a cross-sectional study on 198 subjects (102 men and 96 women, mean age 66 years) at high cardiovascular risk living in Spain, the country with low rates of cardiac death despite a high prevalence of cardiovascular risk factors, dietary data were acquired from FFQ and blood cell membrane fatty acid composition was measured by GC. The average consumption of EPA þ DHA was 0·9 g/d and the mean omega-3 index was 7·1%. In multivariate models, EPA þ DHA intake was the main predictor of the omega-3 index but explained only 12% of its variability (P,0·001). No associations with other dietary fatty acids were observed. Although the single most influential determinant of the omega-3 index measured here was the intake of EPA þ DHA, it explained little of the former"s variability; hence, the effects of other factors (genetic, dietary and lifestyle) remain to be determined. Nevertheless, the high omega-3 index could at least partially explain the paradox of low rates of fatal CHD in Spain despite a high background prevalence of cardiovascular risk factors.

A novel method for quantification of sulfolane (a metabolite of busulfan) in plasma by gas chromatography-tandem mass spectrometry.

The role of busulfan (Bu) metabolites in the adverse events seen during hematopoietic stem cell transplantation and in drug interactions is not explored. Lack of availability of established analytical methods limits our understanding in this area. The present work describes a novel gas chromatography-tandem mass spectrometric assay for the analysis of sulfolane (Su) in plasma of patients receiving high-dose Bu. Su and Bu were extracted from a single 100 μL plasma sample by liquid-liquid extraction. Bu was separately derivatized with 2,3,5,6-tetrafluorothiophenolfluorinated agent. Mass spectrometric detection of the analytes was performed in the selected reaction monitoring mode on a triple quadrupole instrument after electronic impact ionization. Bu and Su were analyzed with separate chromatographic programs, lasting 5 min each. The assay for Su was found to be linear in the concentration range of 20-400 ng/mL. The method has satisfactory sensitivity (lower limit of quantification, 20 ng/mL) and precision (relative standard deviation less than 15 %) for all the concentrations tested with a good trueness (100 ± 5 %). This method was applied to measure Su from pediatric patients with samples collected 4 h after dose 1 (n = 46), before dose 7 (n = 56), and after dose 9 (n = 54) infusions of Bu. Su (mean ± SD) was detectable in plasma of patients 4 h after dose 1, and higher levels were observed after dose 9 (249.9 ± 123.4 ng/mL). This method may be used in clinical studies investigating the role of Su on adverse events and drug interactions associated with Bu therapy.

Determination of trimipramine and its demethylated and hydroxylated metabolites in plasma by gas chromatography-mass spectrometry.

A gas chromatographic-mass spectrometric (GC-MS) method has been developed, for the determination of trimipramine (TRI), desmethyltrimipramine (DTRI), didesmethyltrimipramine (DDTRI), 2-hydroxytrimipramine (2-OH-TRI) and 2-hydroxydesmethyltrimipramine (2-OH-DTRI). The method includes two derivatization steps with trifluoroacetic acid anhydride and N-methyl-N-(tert.-butyldimethyl silyl)trifluoroacetamide and the use of an SE-54 capillary silica column. The limits of quantitation were found to be 2 ng/ml for DTRI and 4 ng/ml for all other substances. Besides, methods have been optimized for the hydrolysis of the glucuronic acid conjugated metabolites. This specific detection method is useful, as polymedication is a usual practice in clinical situations, and its sensitivity allows its use for single-dose pharmacokinetic studies.

Efeito de fungos micorrízicos arbusculares associados a compostos fenólicos, no crescimento de mudas de mamoeiro

Este trabalho foi conduzido em casa de vegetação com objetivo de avaliar os efeitos de diferentes espécies de fungos micorrízicos arbusculares (FMAs) associados a compostos fenólicos (rutina e quercetina), sobre o crescimento e os conteúdos de P de mudas de mamoeiro, sob duas doses de P (0 e 50 mg kg-1). As espécies de fungos utilizadas foram Glomus clarum (Gc), G. macrocarpum (Gm) e uma população nativa de FMAs (Pn) isolada de uma área de plantio de mamão na Estação Experimental da PESAGRO-RIO, em Macaé, RJ. Na dose 0 mg kg-1 de P, a inoculação de Gc aumentou significativamente a produção de matéria seca e os conteúdos de P da parte aérea, independentemente da adição dos compostos rutina ou quercetina. Entretanto, no caso da espécie Gm, estes aumentos só foram observados no tratamento onde se adicionou rutina, o que indica que este composto aumentou a eficiência desta espécie. Não ocorreu influencia significativa da Pn sobre a produção de matéria seca e os conteúdos de P da parte aérea. Com o aumento da dose P (50 mg kg-1), as espécies de FMAs utilizadas não induziram aumento significativo na produção de matéria seca e no conteúdo de P da parte aérea do mamoeiro.

Performance of a chromatographic procedure used in the certification of reference material for polycyclic aromatic hydrocarbons in sewage sludge

Semi-automatic capillary gas chromatographic method with classical flame ionization detection, which satisfies the conditions for required performance and gave acceptable results within the framework of an interlaboratory certification programme for PAHs in sewage sludge, is described. The interesting feature of the procedure is that it incorporates automatic operations such as sample fractionation by semi-preparative HPLC, fraction collection at signal level recognition and evaporation under nitrogen flow. Multiple injections in the GC capillary column are performed in the on-column mode via an autosampler with temperature-programmable injector. Automatic data acquisition and chromatogram treatment are made via computer software. This partially automatic procedure releases personnel from tedious and time-consuming tasks and its robust character was validated through the certification of reference material for PAHs in sewage sludge, demonstrating its reliable performance.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Gas-chromatography mass-spectrometry determination of phthalic acid in human urine as a biomarker of folpet exposure.

Agricultural workers are exposed to folpet, but biomonitoring data are limited. Phthalimide (PI), phthalamic acid (PAA), and phthalic acid (PA) are the ring metabolites of this fungicide according to animal studies, but they have not yet been measured in human urine as metabolites of folpet, only PA as a metabolite of phthalates. The objective of this study was thus to develop a reliable gas chromatography-tandem mass spectrometry (GC-MS) method to quantify the sum of PI, PAA, and PA ring-metabolites of folpet in human urine. Briefly, the method consisted of adding p-methylhippuric acid as an internal standard, performing an acid hydrolysis at 100 °C to convert ring-metabolites into PA, purifying samples by ethyl acetate extraction, and derivatizing with N,O-bis(trimethylsilyl)trifluoro acetamide prior to GC-MS analysis. The method had a detection limit of 60.2 nmol/L (10 ng/mL); it was found to be accurate (mean recovery, 97%), precise (inter- and intra-day percentage relative standard deviations <13%), and with a good linearity (R (2) > 0.98). Validation was conducted using unexposed peoples urine spiked at concentrations ranging from 4.0 to 16.1 μmol/L, along with urine samples of volunteers dosed with folpet, and of exposed workers. The method proved to be (1) suitable and accurate to determine the kinetic profile of PA equivalents in the urine of volunteers orally and dermally administered folpet and (2) relevant for the biomonitoring of exposure in workers.

Comparative analysis of amino acid repeats in rodents and humans

Amino acid tandem repeats, also called homopolymeric tracts, are extremely abundant in eukaryotic proteins. To gain insight into the genome-wide evolution of these regions in mammals, we analyzed the repeat content in a large data set of rat-mouse-human orthologs. Our results show that human proteins contain more amino acid repeats than rodent proteins and that trinucleotide repeats are also more abundant in human coding sequences. Using the human species as an outgroup, we were able to address differences in repeat loss and repeat gain in the rat and mouse lineages. In this data set, mouse proteins contain substantially more repeats than rat proteins, which can be at least partly attributed to a higher repeat loss in the rat lineage. The data are consistent with a role for trinucleotide slippage in the generation of novel amino acid repeats. We confirm the previously observed functional bias of proteins with repeats, with overrepresentation of transcription factors and DNA-binding proteins. We show that genes encoding amino acid repeats tend to have an unusually high GC content, and that differences in coding GC content among orthologs are directly related to the presence/absence of repeats. We propose that the different GC content isochore structure in rodents and humans may result in an increased amino acid repeat prevalence in the human lineage.

A simple gas chromatography method for the analysis of monoethanolamine in air

A simple method determining airborne monoethanolamine has been developed. Monoethanolamine determination has traditionally been difficult due to analytical separation problems. Even in recent sophisticated methods, this difficulty remains as the major issue often resulting in time-consuming sample preparations. Impregnated glass fiber filters were used for sampling. Desorption of monoethanolamine was followed by capillary GC analysis and nitrogen phosphorous selective detection. Separation was achieved using a specific column for monoethanolamines (35% diphenyl and 65% dimethyl polysiloxane). The internal standard was quinoline. Derivatization steps were not needed. The calibration range was 0.5-80 μg/mL with a good correlation (R(2) = 0.996). Averaged overall precisions and accuracies were 4.8% and -7.8% for intraday (n = 30), and 10.5% and -5.9% for interday (n = 72). Mean recovery from spiked filters was 92.8% for the intraday variation, and 94.1% for the interday variation. Monoethanolamine on stored spiked filters was stable for at least 4 weeks at 5°C. This newly developed method was used among professional cleaners and air concentrations (n = 4) were 0.42 and 0.17 mg/m(3) for personal and 0.23 and 0.43 mg/m(3) for stationary measurements. The monoethanolamine air concentration method described here was simple, sensitive, and convenient both in terms of sampling and analytical analysis.

Profilage de la cocaïne : approche inter laboratoires

Introduction Actuellement, les projets européens concernant l'harmonisation des méthodes de profilage se concentrent principalement sur les drogues de type synthétique telles que les ecstasy et les dérivés de la phényléthylamine [Aalberg L. et al. 2005, Aalberg L. et al. 2005, SMT Project 2001, CHAMP Project 2003]. Néanmoins, d'après le rapport annuel 2005 de l'Agence Européenne des Drogues (EMCDDA), la cocaïne est devenue un élément majeur du paysage européen des stupéfiants. De même, les dernières statistiques de l'Office Fédéral de la Police Suisse montrent que les saisies de cocaïne ont quasiment doublé entre 2003 et 2004 pour atteindre des quantités jamais vues auparavant. Le 7ème programme cadre européen, pour la recherche et le développement technologique, propose d'ailleurs un sujet concernant «la détermination et le pistage des composés utilisés lors de la production de certaines substances ». La cocaïne est donc devenue un thème prioritaire en Europe et l'utilisation des méthodes de profilage est un moyen puissant pour établir des liens entre des saisies. Les méthodes de profilage de la cocaïne sont utilisées par quelques laboratoires mais il y a peu ou quasiment pas d'échange d'informations aussi bien concernant les données obtenues que les méthodes utilisées afin d'améliorer la lutte contre le trafic de stupéfiants. Aucune recherche relative à l'harmonisation des méthodes entre deux laboratoires n'a été réalisée à ce jour. Le projet Interreg IIIA avait pour objectif de fournir du renseignement forensique en matière de stupéfiants, plus précisément dans ce cas à la frontière franco-suisse. Le processus de profilage repose sur deux phases interconnectées. La première est consacrée au développement de la méthode analytique permettant l'extraction d'une signature chimique (alcaloïdes et autres composés d'origine, solvants, produits de coupage) ou physique (conditionnement) du produit illicite. La seconde se focalise sur l'intégration des résultats dans un but d'utilisation par les forces de police. Cette recherche s'est tout d'abord focalisée sur le profilage des alcaloïdes en optimisant et en validant la méthode analytique élaborée à l'IPS sur un même GC-FID [Guéniat O. 2004 et Esseiva P. 2004]. Ensuite, la méthode a été étendue à une comparaison de spécimens analysés sur deux appareils différents. Finalement, afin de tester les résultats obtenus par l'analyse des alcaloïdes, une méthode indépendante, la Statique Headspace couplée à un GC-FID, a été, utilisée pour le profilage des solvants. En effet, de nombreux solvants sont utilisés lors de la production de la cocaïne et il doit donc aussi, a priori, être possible d'établir des liens sur la base de cette analyse. Les informations fournies par ces deux méthodes ainsi que leur complémentarité ont été investiguées.

The role of Notch receptors in T helper differentiation

After encountering antigens, naïve CD4+ Τ cells can differentiate into various effector Τ helper (Th) cell subsets, including CD4+ Thi, Th2, Thi7, regulatory Τ cells and the recently described follicular Τ helper cells (TFH cells). To date, most of the studies used either gain-of-function approaches that do not reflect the physiological Notch signaling intensity or loss-of-function models that block the entire Notch pathway. The contribution of single Notch receptors during Th differentiation occurring upon infection has not been investigated yet. In the present thesis, we wanted to assess the individual role of Notchi and Notch2 in Th differentiation, by using mice with Τ cell-specific deletion of Notchi, Notch2 or both (NiN2/iCD4Cre) in different models of infection/immunization.¦In the first part, we characterized the role of Notchi and Notch2 in Thi differentiation. We used experimental infection with the protozoan parasite Leishmania major, known to induce a protective Thi immune response in mice on the C57BL/6 background. Mice deficient for both Notchi and Notch2 developed unhealing lesions and were unable to control the parasite burden in their footpad. A profound defect in IFNy secretion by CD4+ Τ cells was shown to be responsible for the susceptibility of these mice. Although CD4+ Τ cells did not secrete IFNy following L. major infection, they exhibited higher IFNymRNA expression as well as higher frequency of CD4+IFNy+Τ cells in dLN. Altogether, these data indicate that Notch is dispensable for the differentiation of Thi cells expressing IFNy but controls, directly or not, the secretion of IFNy, allowing the development of a fully functional Thi immune response.¦In the second part of this thesis, we determined whether Notch is involved in differentiation of follicular Τ helper (TFH) cells. Using different models of immunization (NP-CGG, Schistosoma mansoni eggs) or infection (Leishmania mexicana), we showed that NiN2ACD4Cre mice were unable to generate TFH cells, displayed impaired germinal center (GC) formation as well as a profound defect in high affinity specific-antibodies secretion. We demonstrated an essential and previously unknown role of Notch in TFH cell development, the consequent GC formation and high affinity antibodies secretion, although the mechanisms by which Notch affects TFH development remain to be clearly demonstrated.¦-¦Lors d'une réponse immune, les lymphocytes Τ CD4+ se différencient en différentes sous- populations de lymphocytes Τ auxiliaires (T helper ou Th en anglais) incluant les populations de cellules Thi, Th2, Thn.7, Τ régulatrices ou Τ folliculaires. De nombreuses études ont montré un rôle de la voie de signalisation Notch dans la différentiation des lymphocytes Τ auxiliaires, bien que les résultats soient controversés. A ce jour, la majorité de ces études sont basées sur des modèles de gain de fonction qui ne reflètent pas le niveau physiologique du signal ou des modèles de perte de fonction pour lesquels toute la voie de signalisation est bloquée. De ce fait, nous avons voulu établir le rôle individuel de Notchi et Notch2 dans la réponse immune de type Thi et dans la différentiation des lymphocytes Τ auxiliaires folliculaires avec l'aide de souris déficientes pour Notchi, Notch2 ou les 2 (NiN2ACD4Cre) à la surface de leurs cellules T.¦Dans la première partie de cette thèse, nous avons analysé le rôle de Notch dans la différentiation de type Thi suite à infection avec le parasite Leishmania major, connu pour induire une forte réponse Thi dans des souris de souche C57BL/6. Les souris déficientes pour Notchi et Notch2 développent une importante lésion et sont incapables de contrôler la prolifération du parasite au site d'infection. Le profond défaut de la sécrétion d'IFNy par les cellules Τ des ganglions drainants est probablement responsable de la susceptibilité de ces souris à L. major. Bien que les cellules Τ ne sécrètent pas d'IFNy, nous avons observé des niveaux plus importants d'expression au niveau de l'ARN messager, et une proportion plus élevée de cellules positives pour CD4 et IFNy. Ces résultats indiquent que Notch est nécessaire pour la sécrétion d'IFNy mais pas pour la différentiation de cellules compétentes pour l'IFNy.¦Dans un second temps, nous avons voulu déterminer si Notch est impliqué dans la différentiation des cellules Τ folliculaires. En utilisant divers modèles d'immunisation (avec NP-CGG ou des oeufs de Schistosoma mansoni) ou d'infection (avec L. mexicana), nous avons montré que les souris NlN2ACD4Cre sont incapables de générer des cellules Τ folliculaires. En conséquence, la formation des centres germinatifs et la sécrétion d'anticorps de haute affinité sont profondément affectés. Nous avons démontré dans cette seconde partie un rôle crucial et inconnu à ce jour de Notch dans la différentiation des cellules Τ et en conséquence dans la formation des centres germinatifs et la sécrétion des anticorps de haute affinité, bien que les mécanismes par lesquels Notch contrôle cette différentiation restent à identifier.¦-¦Lors d'une réponse immune, les lymphocytes Τ CD// se différencient en différentes sous- populations de lymphocytes Τ auxiliaires de types Thi, Th2, Thi7, régulatrices ou folliculaires, définies selon la sécrétion de cytokines spécifiques. Le rôle de ces sous-populations dans le contrôle de diverses infections ou leur association avec de nombreuses maladies rend la compréhension des mécanismes de différentiation de ces cellules particulièrement importante. De nombreux facteurs sont impliqués dans ce processus, tels que la présence de diverses cytokines dans l'environnement, la nature de l'antigène ou encore la force de la stimulation. Par ailleurs, de nombreuses études ont montré un rôle de la voie de signalisation Notch dans la différentiation des lymphocytes T, bien que les résultats soient controversés. Dans cette thèse, nous avons voulu évaluer le rôle individuel des récepteurs Notch dans la différentiation des cellules Τ auxiliaires de type Thi et folliculaires à l'aide de souris dont les récepteurs Notch sont spécifiquement absents à la surface des lymphocytes T.¦Dans la première partie, nous avons utilisé le modèle d'infection au parasite Leishmania major, connu pour induire une forte réponse protectrice de type Thi dans la majorité des souches de souris. Suite à l'infection, les souris déficientes pour les récepteurs Notch sont incapables de contrôler la prolifération du parasite et développent une importante lésion au site d'infection. Cette susceptibilité est due à l'incapacité des cellules Τ auxiliaires à sécréter une cytokine spécifique des cellules de type Thi et nécessaire à l'éradication du parasite, l'IFNy. Ces résultats indiquent que les récepteurs Notch sont indispensables au développement d'une réponse Thi fonctionnelle, permettant la guérison suite à l'infection avec L. major.¦Dans la deuxième partie de cette thèse, nous avons voulu déterminer si Notch est impliqué dans la différentiation des lymphocytes Τ folliculaires. Ces cellules ont la particularité d'aider les lymphocytes Β à former des centres germinatifs au sein desquels les lymphocytes Β prolifèrent et sécrètent des anticorps, un processus nécessaire à la protection contre les pathogènes. Actuellement, l'efficacité de la majorité des vaccins repose sur la sécrétion d'anticorps par les lymphocytes B, aidés par les cellules Τ folliculaires. En raison du rôle important de ces cellules dans l'éradication des pathogènes et lors d'un processus de vaccination, il est important de connaître les facteurs et les mécanismes permettant la différentiation de ces cellules. Dans cette étude, nous montrons que la formation des cellules Τ folliculaires dépend de la voie de signalisation Notch, impliquant un rôle essentiel de cette molécule dans l'induction de la sécrétion d'anticorps par les lymphocytes B.

Characterization of rapeseed (Brassica napus) oils by bulk C, O, H, and fatty acid C stable isotope analyses

Rapeseed (Brassica napus) oils differing in cultivar, sites of growth, and harvest year were characterized by fatty acid concentrations and carbon, hydrogen, and oxygen stable isotope analyses of bulk oils (delta(13)C(bulk), delta(2)H(bulk), delta(18)O(bulk) values) and individual fatty acids (delta(13)C(FA)). The delta(13)C(bulk), delta(2)H(bulk), and delta(18)O(bulk) values were determined by continuous flow combustion and high-temperature conversion elemental analyzer isotope ratio mass spectrometry (EA/IRMS, TC-EA/IRMS). The delta(13)C(FA) values were determined using gas chromatography-combustion isotope ratio mass spectrometry (GC/C/IRMS). For comparison, other C(3) vegetable oils rich in linolenic acid (flax and false flax oils) and rich in linoleic acid (poppy, sunflower, and safflower oils) were submitted to the same chemical and isotopic analyses. The bulk and molecular delta(13)C values were typical for C(3) plants. The delta(13)C value of palmitic acid (delta(13)C(16:0)) and n-3 alpha-linolenic acid (delta(13)C(18:3n-3)) differed (p < 0.001) between rape, flax, and poppy oils. Also within species, significant differences of delta(13)C(FA) were observed (p < 0.01). The hydrogen and oxygen isotope compositions of rape oil differed between cultivars (p < 0.05). Major differences in the individual delta(13)C(FA) values were found. A plant-specific carbon isotope fractionation occurs during the biosynthesis of the fatty acids and particularly during desaturation of C(18) acids in rape and flax. Bulk oil and specific fatty acid stable isotope analysis might be useful in tracing dietary lipids differing in their origin.