952 resultados para DNA sequence
Resumo:
The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.
Resumo:
We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.
Resumo:
Accurate prediction of transcription factor binding sites is needed to unravel the function and regulation of genes discovered in genome sequencing projects. To evaluate current computer prediction tools, we have begun a systematic study of the sequence-specific DNA-binding of a transcription factor belonging to the CTF/NFI family. Using a systematic collection of rationally designed oligonucleotides combined with an in vitro DNA binding assay, we found that the sequence specificity of this protein cannot be represented by a simple consensus sequence or weight matrix. For instance, CTF/NFI uses a flexible DNA binding mode that allows for variations of the binding site length. From the experimental data, we derived a novel prediction method using a generalised profile as a binding site predictor. Experimental evaluation of the generalised profile indicated that it accurately predicts the binding affinity of the transcription factor to natural or synthetic DNA sequences. Furthermore, the in vitro measured binding affinities of a subset of oligonucleotides were found to correlate with their transcriptional activities in transfected cells. The combined computational-experimental approach exemplified in this work thus resulted in an accurate prediction method for CTF/NFI binding sites potentially functioning as regulatory regions in vivo.
Resumo:
The complete mitochondrial DNA (mtDNA) control region was amplified and directly sequenced in two species of shrew, Crocidura russula and Sorex araneus (Insectivora, Mammalia). The general organization is similar to that found in other mammals: a central conserved region surrounded by two more variable domains. However, we have found in shrews the simultaneous presence of arrays of tandem repeats in potential locations where repeats tend to occur separately in other mammalian species. These locations correspond to regions which are associated with a possible interruption of the replication processes, either at the end of the three-stranded D-loop structure or toward the end of the heavy-strand replication. In the left domain the repeated sequences (R1 repeats) are 78 bp long, whereas in the right domain the repeats are 12 bp long in C. russula and 14 bp long in S. araneus (R2 repeats). Variation in the copy number of these repeated sequences results in mtDNA control region length differences. Southern blot analysis indicates that level of heteroplasmy (more than one mtDNA form within an individual) differs between species. A comparative study of the R2 repeats in 12 additional species representing three shrew subfamilies provides useful indications for the understanding of the origin and the evolution of these homologous tandemly repeated sequences. An asymmetry in the distribution of variants within the arrays, as well as the constant occurrence of shorter repeated sequences flanking only one side of the R2 arrays, could be related to asymmetry in the replication of each strand of the mtDNA molecule. The pattern of sequence and length variation within and between species, together with the capability of the arrays to form stable secondary structures, suggests that the dominant mechanism involved in the evolution of these arrays in unidirectional replication slippage.
Resumo:
The shrews of the Sorer araneus group have undergone a spectacular chromosome evolution. The karyotype of Sorer granarius is generally considered ancestral to those of Sorer coronatus and S. araneus. However, a sequence of 777 base pairs of the cytochrome b gene of the mitochondrial DNA (mtDNA) produces a quite different picture: S. granarius is closely related to the populations of S. araneus from the Pyrenees and from the northwestern Alps, whereas S. coronatus and S. araneus from Italy and the southern Alps represent two well-separated lineages. It is suggested that mtDNA and chromosomal evolution are in this case largely independant processes. Whereas mtDNA haplotypes are closely linked to the geographical history of the populations, chromosomal mutations were probably transmitted from one population to another. Available data suggest that the impressive chromosome polymorphism of this group is quite a recent phenomenon.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.
Resumo:
In the presence of 2-hydroxybiphenyl, the enhancer binding protein, HbpR, activates the sigma54-dependent P(hbpC) promoter and controls the initial steps of 2-hydroxybiphenyl degradation in Pseudomonas azelaica. In the activation process, an oligomeric HbpR complex of unknown subunit composition binds to an operator region containing two imperfect palindromic sequences. Here, the HbpR-DNA binding interactions were investigated by site-directed mutagenesis of the operator region and by DNA-binding assays using purified HbpR. Mutations that disrupted the twofold symmetry in the palindromes did not affect the binding affinity of HbpR, but various mutations along a 60 bp region, and also outside the direct palindromic sequences, decreased the binding affinity. Footprints of HbpR on mutant operator fragments showed that a partial loss of binding contacts occurs, suggesting that the binding of one HbpR 'protomer' in the oligomeric complex is impaired whilst leaving the other contacts intact. An HbpR variant, devoid of its N-terminal sensing A-domain, was unable to activate transcription from the hbpC promoter while maintaining protection of the operator DNA in footprints. Wild-type HbpR was unable to activate transcription from the hbpC promoter when delta A-HbpR was expressed in the same cell, suggesting the formation of (repressing) hetero-oligomers. This model implies that HbpR can self-associate on its operator DNA without effector recognition or ATP binding. Furthermore, our findings suggest that the N-terminal sensing domain of HbpR is needed to activate the central ATPase domain rather than to repress a constitutively active C domain, as is the case for the related regulatory protein XylR.
Resumo:
BACKGROUND: The genome of Protochlamydia amoebophila UWE25, a Parachlamydia-related endosymbiont of free-living amoebae, was recently published, providing the opportunity to search for genomic islands (GIs). RESULTS: On the residual cumulative G+C content curve, a G+C-rich 19-kb region was observed. This sequence is part of a 100-kb chromosome region, containing 100 highly co-oriented ORFs, flanked by two 17-bp direct repeats. Two identical gly-tRNA genes in tandem are present at the proximal end of this genetic element. Several mobility genes encoding transposases and bacteriophage-related proteins are located within this chromosome region. Thus, this region largely fulfills the criteria of GIs. The G+C content analysis shows that several modules compose this GI. Surprisingly, one of them encodes all genes essential for F-like conjugative DNA transfer (traF, traG, traH, traN, traU, traW, and trbC), involved in sex pilus retraction and mating pair stabilization, strongly suggesting that, similarly to the other F-like operons, the parachlamydial tra unit is devoted to DNA transfer. A close relatedness of this tra unit to F-like tra operons involved in conjugative transfer is confirmed by phylogenetic analyses performed on concatenated genes and gene order conservation. These analyses and that of gly-tRNA distribution in 140 GIs suggest a proteobacterial origin of the parachlamydial tra unit. CONCLUSIONS: A GI of the UWE25 chromosome encodes a potentially functional F-like DNA conjugative system. This is the first hint of a putative conjugative system in chlamydiae. Conjugation most probably occurs within free-living amoebae, that may contain hundreds of Parachlamydia bacteria tightly packed in vacuoles. Such a conjugative system might be involved in DNA transfer between internalized bacteria. Since this system is absent from the sequenced genomes of Chlamydiaceae, we hypothesize that it was acquired after the divergence between Parachlamydiaceae and Chlamydiaceae, when the Parachlamydia-related symbiont was an intracellular bacteria. It suggests that this heterologous DNA was acquired from a phylogenetically-distant bacteria sharing an amoebal vacuole. Since Parachlamydiaceae are emerging agents of pneumonia, this GI might be involved in pathogenicity. In future, conjugative systems might be developed as genetic tools for Chlamydiales.
Resumo:
The M-Coffee server is a web server that makes it possible to compute multiple sequence alignments (MSAs) by running several MSA methods and combining their output into one single model. This allows the user to simultaneously run all his methods of choice without having to arbitrarily choose one of them. The MSA is delivered along with a local estimation of its consistency with the individual MSAs it was derived from. The computation of the consensus multiple alignment is carried out using a special mode of the T-Coffee package [Notredame, Higgins and Heringa (T-Coffee: a novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 2000; 302: 205-217); Wallace, O'Sullivan, Higgins and Notredame (M-Coffee: combining multiple sequence alignment methods with T-Coffee. Nucleic Acids Res. 2006; 34: 1692-1699)] Given a set of sequences (DNA or proteins) in FASTA format, M-Coffee delivers a multiple alignment in the most common formats. M-Coffee is a freeware open source package distributed under a GPL license and it is available either as a standalone package or as a web service from www.tcoffee.org.
Resumo:
Stable protein-DNA complexes can be assembled in vitro at the 5' end of Xenopus laevis vitellogenin genes using extracts of nuclei from estrogen-induced frog liver and visualized by electron microscopy. Complexes at the three following sites can be identified on the gene B2: the transcription initiation site, the estrogen responsive element (ERE) and in the first intron. The complex at the transcription initiation site is stabilized by dinucleotides and thus represents a ternary transcription complex. The formation of the complexes at the two other sites is enhanced by estrogen and is reduced by tamoxifen, an antagonist of estrogen, while this latter effect is reversed by adding an excess of hormone. No sequence homology is apparent between the site containing the ERE and the binding site in intron I and functional tests in MCF-7 cells suggest that these two sites are not equivalent. Finally, we made use of previously characterized deletion mutants of the 5' flanking region of the gene B1, a close relative of the gene B2, to demonstrate that the 13-bp palindromic core element of the ERE is involved in the formation of the complexes observed upstream of the transcription initiation site.
Resumo:
A central question in developmental biology is how multicellular organisms coordinate cell division and differentiation to determine organ size. In Arabidopsis roots, this balance is controlled by cytokinin-induced expression of SHORT HYPOCOTYL 2 (SHY2) in the so-called transition zone of the meristem, where SHY2 negatively regulates auxin response factors (ARFs) by protein-protein interaction. The resulting down-regulation of PIN-FORMED (PIN) auxin efflux carriers is considered the key event in promoting differentiation of meristematic cells. Here we show that this regulation involves additional, intermediary factors and is spatio-temporally constrained. We found that the described cytokinin-auxin crosstalk antagonizes BREVIS RADIX (BRX) activity in the developing protophloem. BRX is an auxin-responsive target of the prototypical ARF MONOPTEROS (MP), a key promoter of vascular development, and transiently enhances PIN3 expression to promote meristem growth in young roots. At later stages, cytokinin induction of SHY2 in the vascular transition zone restricts BRX expression to down-regulate PIN3 and thus limit meristem growth. Interestingly, proper SHY2 expression requires BRX, which could reflect feedback on the auxin responsiveness of SHY2 because BRX protein can directly interact with MP, likely acting as a cofactor. Thus, cross-regulatory antagonism between BRX and SHY2 could determine ARF activity in the protophloem. Our data suggest a model in which the regulatory interactions favor BRX expression in the early proximal meristem and SHY2 prevails because of supplementary cytokinin induction in the later distal meristem. The complex equilibrium of this regulatory module might represent a universal switch in the transition toward differentiation in various developmental contexts.
Resumo:
We have shown that indels in gp120 V4 are associated to the presence of duplicated and palindromic sequences, suggesting that they may be produced by strand-slippage misalignment mechanism. Indels in V4 involved region-specific duplications 9 to 15 bp long, and repeats of various lengths, associated to trinucleotides AAT. No duplications were found in V3 and C3. The frequency of palindromic sequences in individual genes was found to be significantly higher in gp120 (p < or = 3.00E-7), and significantly lower in Tat (p < or = 9.00E-7) than the average frequency calculated over the full genome. The finding of elements of misalignment in association with indels in V4 suggests that these mutations may occur in proviral DNA after integration of HIV into the host genome. It also implies that occurrence of large indels in gp120 is not random but is directed by the presence and distribution of elements of misalignment in the HIV genome.
Resumo:
We examined the sequence variation of mitochondrial DNA control region and cytochrome b gene of the house mouse (Mus musculus sensu lato) drawn from ca. 200 localities, with 286 new samples drawn primarily from previously unsampled portions of their Eurasian distribution and with the objective of further clarifying evolutionary episodes of this species before and after the onset of human-mediated long-distance dispersals. Phylogenetic analysis of the expanded data detected five equally distinct clades, with geographic ranges of northern Eurasia (musculus, MUS), India and Southeast Asia (castaneus, CAS), Nepal (unspecified, NEP), western Europe (domesticus, DOM) and Yemen (gentilulus). Our results confirm previous suggestions of Southwestern Asia as the likely place of origin of M. musculus and the region of Iran, Afghanistan, Pakistan, and northern India, specifically as the ancestral homeland of CAS. The divergence of the subspecies lineages and of internal sublineage differentiation within CAS were estimated to be 0.37-0.47 and 0.14-0.23 million years ago (mya), respectively, assuming a split of M. musculus and Mus spretus at 1.7 mya. Of the four CAS sublineages detected, only one extends to eastern parts of India, Southeast Asia, Indonesia, Philippines, South China, Northeast China, Primorye, Sakhalin and Japan, implying a dramatic range expansion of CAS out of its homeland during an evolutionary short time, perhaps associated with the spread of agricultural practices. Multiple and non-coincident eastward dispersal events of MUS sublineages to distant geographic areas, such as northern China, Russia and Korea, are inferred, with the possibility of several different routes.
Resumo:
To understand the biology and evolution of ruminants, the cattle genome was sequenced to about sevenfold coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1217 are absent or undetected in noneutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides a resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production.