993 resultados para An-Ski, Š.An-Ski, Š.Š.An-Ski
Resumo:
This paper examines upper-body movement kinematics in individuals with high-functioning autism (HFA) and Asperger's disorder (AD). In general, the results indicate that HFA is more consistently associated with impaired motoric preparation/initiation than AD. The data further suggest that this quantitative difference in motor impairment is not necessarily underpinned by greater executive dysfunction vulnerability in autism relative to AD. Quantitative motoric dissociation between autism and AD may have down-stream effects on later stages of movement resulting in qualitative differences between these disorder groups, e.g. motor clumsiness in AD versus abnormal posturing in autism. It will be important for future research to map the developmental trajectory of motor abnormalities in these disorder groups.
Resumo:
Vertical direct chill (VDC) casting of aluminium alloys is a mature process that has evolved over many decades through gradual change to both equipment design and casting practice. Today, air-pressurised, continuous lubrication, hot top mould systems with advanced station automation are selected as the process of choice for producing extrusion billet. Specific sets of operating parameters are employed on these stations for each alloy and size combination to produce optimal billet quality. The designs and parameters are largely derived from past experience and accumulated know-how. Recent experimental work at the University of Queensland has concentrated on understanding the way in which the surface properties of liquid aluminium alloys, e.g., surface tension, wetting angle and oxide skin strength, influence the size and shape of the naturally-stab le meniscus for a given alloy, temperature and atmosphere. The wide range of alloy-and condition-dependent values measured has led to the consideration of how these properties impact the stability of the enforced molten metal meniscus within the hot top mould cavity. The actual shape and position of the enforced meniscus is controlled by parameters such as the upstream conduction distance (UCD) from sub-mould cooling and the molten metal head. The degree of deviation of this actual meniscus from the predicted stable meniscus is considered to be a key driver in surface defect formation. This paper reports on liquid alloy property results and proposes how this knowledge might be used to better design VDC mould systems and casting practices.
Resumo:
Conditions which influence the viability, integrity, and extraction efficiency of the isolated perfused rat liver were examined to establish optimal conditions for subsequent work in reperfusion injury studies including the choice of buffer, use of oncotic agents, hematocrit, perfusion flow rate, and pressure. Rat livers were perfused with MOPS-buffered Ringer solution with or without erythrocytes. Perfusates were collected and analyzed for blood gases, electrolytes, enzymes, radioactivity in MID studies, and lignocaine in extraction studies. Liver tissue was sampled for histological examinations, and wet:dry weight of the liver was also determined. MOPS-buffered Ringer solution was found to be superior to Krebs bicarbonate buffer, in terms of pH control and buffering capacity, especially during any prolonged period of liver perfusion. A pH of 7.2 is chosen for perfusion since this is the physiological pH of the portal blood. The presence of albumin was important as an oncotic agent, particularly when erythrocytes were used in the perfusate. Perfusion pressure, resistance, and vascular volume are how-dependent and the inclusion of erythrocytes in the perfusate substantially altered the flow characteristics for perfusion pressure and resistance but not vascular volume. Lignocaine extraction was relatively flow-independent. Perfusion injury as defined by enzyme release and tissue fine structure was closely related to the supply of O-2. The optimal conditions for liver perfusion depend upon an adequate supply of oxygen. This can be achieved by using either erythrocyte-free perfusate at a how rate greater than 6 ml/min/g liver or a 20% erythrocyte-containing perfusate at 2 ml/min/g. (C) 1996 Academic Press, Inc.
Resumo:
To describe the case of a patient with celiac disease who achieved a complete response to a gluten-free diet. A 28-year-old woman presented with diarrhea, oral ulcers, and refractory uveitis of 2.5-years duration. She was treated with prednisone, mydriatic drops, and infliximab with no response. She was referred to our hospital at which point her previous diagnosis of uveitis was confirmed; she was also diagnosed with right-sided sacro-iliitis. The patient did not have arthritis or any skin conditions. Three tests for fecal parasites and a fecal leukocyte were negative. Endoscopy revealed atrophic appearance of the duodenal mucosa. Biopsy showed atrophy of the duodenal villi with intra-epithelial lymphocytes, hyperplasia of the crypts, and chronic inflammatory infiltrate. The search for antiendomysial antibody was > 1/1,280. The patient was started on a gluten-free diet and after 3 months demonstrated significant improvement of gastrointestinal symptoms and uveitis, as well as a reduction of antiendomysial antibodies (1/80). After 6 months, there was complete remission of gastrointestinal symptoms and total control of uveitis. The antiendomysial antibody was negative at that time. Clinical uveitis as a manifestation of celiac disease has been described in only two cases in the literature. This case study is the third to demonstrate that uveitis is a clinical symptom that can be addressed in patients with celiac disease.
Resumo:
Background: Recent studies have assessed the direct effects of smoking on cardiac remodeling and function. However, the mechanisms of these alterations remain unknown. The aim of this study was to investigate de role of cardiac NADPH oxidase and antioxidant enzyme system on ventricular remodeling induced by tobacco smoke. Methods: Male Wistar rats that weighed 200-230 g were divided into a control group (C) and an experimental group that was exposed to tobacco smoke for a period of two months (ETS). After the two-month exposure period, morphological, biochemical and functional analyses were performed. Results: The myocyte cross-sectional area and left ventricle end-diastolic dimension was increased 16.2% and 33.7%, respectively, in the ETS group. The interstitial collagen volume fraction was also higher in ETS group compared to the controls. In addition to these morphological changes, the ejection fraction and fractional shortening were decreased in the ETS group. Importantly, these alterations were related to augmented heart oxidative stress, which was characterized by an increase in NADPH oxidase activity, increased levels of lipid hydroperoxide and depletion of antioxidant enzymes (e.g., catalase, superoxide dismutase and glutathione peroxidase). In addition, cardiac levels of IFN-gamma, TNF-alpha and IL-10 were not different between the groups. Conclusion: Cardiac alterations that are induced by smoking are associated with increased NADPH oxidase activity, suggesting that this pathway plays a role in the ventricular remodeling induced by exposure to tobacco smoke. Copyright (C) 2011 S. Karger AG, Basel
Resumo:
Background The objective of this study was to evaluate the early results of the laparoscopic interposition of a segment of ileum associated with a sleeve gastrectomy (LII-SG) in order to treat patients with type 2 diabetes mellitus (T2DM) and BMI <35. Data regarding morbidly obese diabetic patients subjected to surgery has consistently been validated. To date, there is scarce information about morbidity and mortality related to the surgical treatment of a ""true"" typical diabetic population with BMI <35. Methods The procedures were performed in 454 patients (322 male, 132 female). Mean age was 53.6 +/- 8 years (range = 27-75). Mean BMI was 29.7 +/- 3.6 kg/m(2) (range = 19-34.8). All patients had the diagnosis of T2DM for at least 3 years. Insulin therapy was used by 45.6% of patients. Mean duration of T2DM was 10.8 +/- 5.9 years (range = 3-35). Mean hemoglobin A(1c) was 8.8 +/- 1.9%. Dyslipidemia was observed in 78.4%, hypertension in 64.8%, nephropathy in 28.6%, retinopathy in 32.6%, neuropathy in 34.6%, and coronary heart disease in 13%. Results There was no conversion to open surgery. All patients were evaluated postoperatively. Mortality was 0.4%. There were 29 major complications (6.4%) in 22 patients (4.8%) and 51 minor complications (11.2%). Reoperations were performed on 8 patients (1.7%). Twenty patients (4.4%) were readmitted to the hospital. Mean postoperative BMI was 25.8 +/- 3.5 kg/m(2). Mean fasting plasma glucose decreased from 198 +/- 69 to 128 +/- 67 mg/dl and mean postprandial plasma glucose decreased from 262 +/- 101 to 136 +/- 43 mg/dl. Conclusions The laparoscopic ileal interposition associated with a sleeve gastrectomy was considered a safe operation with low rates of morbidity and mortality in a diabetic population with BMI < 35. An early control of postprandial glycemia was observed.
Resumo:
Single session repetitive transcranial magnetic stimulation (rTMS) of the motor cortex (M1) is effective in the treatment of chronic pain patients but the analgesic effect of repeated sessions is still unknown We evaluated the effects of rTMS in patients with refractory pain due to complex regional pain syndrome (CRPS) type I Twenty three patients presenting CRPS type I of 1 upper limb were treated with the best medical treatment (analgesics and adjuvant medications physical therapy) plus 10 daily sessions of either real (r) or sham (s) 10Hz rTMS to the motor cortex (M1) Patients were assessed daily and after 1 week and 3 months after the last session using the Visual Analogical Scale (VAS) the McGill Pain Questionnaire (MPQ) the Health Survey 36 (SF 36) and the Hamilton Depression (HDRS) During treatment there was a significant reduction in the VAS scores favoring the r rTMS group mean reduction of 4 65 cm (50 9%) against 2 18 cm (24 7%) in the s rTMS group The highest reduction occurred at the tenth session and correlated to improvement in the affective and emotional subscores of the MPQ and SF 36 Real rTMS to the M1 produced analgesic effects and positive changes in affective aspects of pain in CRPS patients during the period of stimulation Perspective This study shows an efficacy of repetitive sessions of high frequency rTMS as an add on therapy to refractory CAPS type I patients It had a positive effect in different aspects of pain (sensory discriminative and emotional affective) It opens the perspective for the clinical use of this technique (C) 2010 by the American Pain Society
Resumo:
Background:. Although the role of the lung alveolar macrophage (AM) as a mediator of acute lung injury (ALI) after lung ischemia/reperfusion (I/R) has been suggested by animal experiments, it has not been determined whether AMs mediate ALI after intestinal I/R. The objective of this study was to determine the effect of AM elimination on ALI after intestinal I/R in rats. Mwthods: Male Wistar rats (n = 90) were randomly divided into three groups: the clodronate-liposomes (CLOD-LIP) group received intratracheal treatment with CLOD-LIP; the liposomes (LIP) group received intratracheal treatment with LIP; and the nontreated (UNTREAT) group received no treatment. Twenty-four hours later each group was randomly divided into three subgroups: the intestinal I/R subgroup was subjected to 45-minute intestinal ischemia and 2-hour reperfusion; the laparotomy (LAP) subgroup was subjected to LAP and sham procedures; the control (CTR) subgroup received no treatment. At the end of reperfusion, ALI was quantitated in all the animals by the Evans blue dye (EBD) method. Results: ALI values are expressed as EBD lung leakage (mu g EBD/g dry lung weight). EBD lung leakage values in the CLOD-LIP group were 32.59 +/- 12.74 for I/R, 27.74 +/- 7.99 for LAP, and 33.52 +/- 10.17 for CTR. In the LIP group, lung leakage values were 58.02 +/- 18.04 for I/R, 31.90 +/- 8.72 for LAP, and 27.17 +/- 11.48 for CTR. In the UNTREAT group, lung leakage values were 55.60 +/- 10.96 for I/R, 35.99 +/- 6.89 for LAP, and 30.83 +/- 8.41 for CTR. Within each group, LAP values did not differ from CTR values. However, in the LIP and UNTREAT groups, values for both the LAP and CTR subgroups were lower than values for the I/R subgroup (p < 0.001). The CLOD-LIP I/R subgroup value was less (p < 0.001) than the I/R subgroup values in the LIP and UNTREAT groups. These results indicated that I/R provokes ALI that can be prevented by CLOD-LIP treatment, and further suggested that AMs are essential for ALI occurrence induced by intestinal I/R in rats.
Resumo:
Purpose: Most groups have reported disappointing results with autoaugmentation or detrusor myectomy for low capacity/compliance neuropathic bladders. Failure may be due to an ischemic diverticulum or mucosal shrinkage. We investigated whether a Silimed (R) silicone balloon placed in the bladder after autoaugmentation could prevent these problems, improving surgical results. Materials and Methods: We compared the results of standard bladder autoaugmentation in 12 children (group 1) with those in 10 (group 2) who underwent the same surgery using a bladder conformer. The conformer was a silicone balloon filled with saline that remained in the bladder for 2 weeks. All patients had a neuropathic bladder with poor capacity and compliance, resulting in urinary leakage between catheterizations. Preoperative and postoperative evaluation included a voiding diary, ultrasound, voiding cystourethrogram and urodynamics. Results: In group 1 only 1 patient became dry, 4 had little improvement in continence, 4 remained unchanged and 3 became worse. In group 2, 6 patients (60%) become continent without medication, 2 (20%) become continent with oxybutynin and 2 remained unchanged. Bladder capacity and compliance did not change significantly in group 1. However, in group 2 capacity changed from a mean of 140 to 240 ml and mean +/- SD compliance increased from 15.6 +/- 16.8 to 34.3 +/- 22.8 ml/cm H(2)O (p = 0.02). Conclusions: The inflatable balloon improved our long-term results of bladder auto-augmentation. A larger series may be necessary to confirm procedure efficacy and safety.
Resumo:
To understand the dynamic mechanisms of the mechanical milling process in a vibratory mill, it is necessary to determine the characteristics of the impact forces associated with the collision events. However, it is difficult to directly measure the impact force in an operating mill. This paper describes an inverse technique for the prediction of impact forces from acceleration measurements on a vibratory ball mill. The characteristics of the vibratory mill have been investigated by the modal testing technique, and its system modes have been identified. In the modelling of the system vibration response to the impact forces, two modal equations have been used to describe the modal responses. The superposition of the modal responses gives rise to the total response of the system. A method based on an optimisation approach has been developed to predict the impact forces by minimising the difference between the measured acceleration of the vibratory ball mill and the predicted acceleration from the solution of the modal equations. The predicted and measured impact forces are in good agreement. Copyright (C) 1996 Elsevier Science Ltd.
Resumo:
Pentoxifylline (PTF), a methylxanthine derivative, has therapeutic use as an antifibrotic agent. In vitro, PTF inhibits the production of collagen and reduces the proliferation of fibroblasts in hypertrophic scars. This study aimed to evaluate changes in the elasticity of hypertrophic scars in the peribuccal area in burned patients, who presented with mouth-opening limitation. Eighteen patients were divided into two groups. The case group (n = 10) was treated with PTF 1 mg ml(-1), while in the control group (n = 8) no treatment was performed. Measurements of mouth opening (lip-to-lip and tooth-to-tooth distances in mm) were taken, before and after five therapeutic sessions with pentoxifylline with weekly intervals. The variations of these measures (Delta%) were calculated and submitted to statistical analyses. There was a significant improvement in the opening of the mouth, in vermilion distance (V = 3.20 mm) as much as the dental distance (DD = 4.19 mm) in the treated group, than in the control group. It was noted that pentoxifylline increases the elasticity of hypertrophic scars in the perioral area. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.
Resumo:
The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).