925 resultados para function and evolution


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: To evaluate the influence of end-stage liver disease and orthotopic liver transplantation in the pituitary function and hormone metabolism before and after liver transplantation.Methods: In a prospective study, serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2) and prolactin (PRL) of 30 male patients with cirrhosis were determined two to four hours before and six months after liver transplantation. The results were compared according to the Model for End-stage Liver Disease (MELD).Results: male patients with liver cirrhosis have hypogonadism. FSH was normal, but inappropriately low due to androgen failure; E2 and PRL, on their turn, were high. After liver transplantation, FSH and LH levels increased (p < 0.05), whereas E2 and PRL normalized (p < 0.05). The MELD score did not influence changes in FSH, PRL and LH, however, the more severe the cirrhosis was, the more significant was the normalization of E2 (p = 0.01).Conclusion: Patients with cirrhosis and male hypogonadism have inappropriately normal levels of FSH and LH, associated with an increase in E2 and LRP. After liver transplantation, FSH and LH increased, while E2 and PRL returned to normal. Changes in E2 levels were most pronounced in patients with MELD > 18. The severity of cirrhosis had no influence on FSH, PRL and LH.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A review of our recent work on the cromosomal evolution of the Drosophila repleta species group is presented. Most studies have focused on the buzzatii species complex, a monophyletic set of 12 species which inhabit the deserts of South America and the West Indies. A statistical analysis of the length and breakpoint distribution of the 86 paracentric inversions observed in this complex has shown that inversion length is a selected trait. Rare inversions are usually small while evolutionary successful inversions, fixed and polymorphic, are predominantly of medium size. There is also a negative correlation between length and number of inversions per species. Finally, the distribution of inversion breakpoints along chromosome 2 is non-random, with chromosomal regions which accumulate up to 8 breakpoints (putative "hot spots"). Comparative gene mapping has also been used to investigate the molecular organization and evolution of chromosomes. Using in situ hybridization, 26 genes have been precisely located on the salivary gland chromosomes of D. repleta and D. buzzatii; another nine have been tentatively identified. The results are fully consistent with the currently accepted chromosomal homologies between D. repleta and D. melanogaster, and no evidence for reciprocal translocations or pericentric inversions has been found. The comparison of the gene map of D. repleta chromosome 2 with that of the homologous chromosome 3R of D. melanogaster shows an extensive reorganization via paracentric inversions and allows to estimate an evolution rate of ~1 inversion fixed per million years for this chromosome

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cystic fibrosis (CF) is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR). Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs), and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The effects of strenuous exercise before and during pregnancy on the renal function and morphological alterations of the progeny were determined in a study on female Wistar rats. This research was done based on a previous study carried out in our laboratory, which showed morphological alterations in rats submitted to this kind of exercise. As the form is related to the function, the physiological relevance of submitting a pregnant female to a high-intensity exercise training regimen could be explained by the fact that morphological alterations can influence kidney function. The animals were assigned to one of two groups: control animals that did not exercise during pregnancy and trained animals that swam for 120 min 5 days a week for 8 weeks before pregnancy and daily for 60 min over a period of 8 weeks starting on the second day of pregnancy. Seven rats of each group were analyzed for morphological alterations and for renal function. The progeny of the rats used for morphological evaluation were born by cesarean section and the progeny of the animals used to evaluate renal function were born normally. The progeny were two months old when renal function was evaluated. Fertility and morbidity were the same for both groups. Strenuous maternal exercise had no significant influence on glomerular filtration rate (GFR) but renal plasma flow was lower in the progeny of the trained group (mean ± SD, 16.65 ± 3.77 ml min-1 kg-1) compared to the progeny of the control group (33.42 ± 2.56 ml min-1 kg-1). Antidiuretic and antinatriuretic effects on the progeny of the trained group were observed, since urine flow as percentage of GFR and the fraction of urinary sodium excretion were lower in this group (1.38 ± 0.10 and 0.60 ± 0.04%, respectively) compared to the progeny of the control group (2.36 ± 0.11 and 1.55 ± 0.20%, respectively). Moreover, in this exercise program, fetuses from trained animals were small-sized (2.45 ± 0.19 vs 4.66 ± 2.45 g for control animals) and showed lower differentiation compared to fetuses from the control group. These effects were probably caused by caloric restriction, hypoxia and reduction of umbilical cord length.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of the present study was to determine contrast sensitivity curves of concentric circular patterns with radial frequencies of 0.25, 0.5, 1.0, 2.0, and 4.0 cycles per degree in young and older adult volunteers. These parameters were also compared with sensitivity contrasts for sine-wave gratings. All participants had normal acuity vision and were free of identifiable ocular illness. Contrast sensitivity was measured in 6 young adults aged 19 to 23 years and 6 older adults aged 60 to 69 years using the psychophysical forced-choice method. In this paradigm the volunteers had to decide which of two stimuli contained the above radial frequencies at low contrast levels. The other neutral stimulus was gray with homogeneous luminance. We detected a decline in contrast sensitivity for older adults at all radial frequencies compared to young adults. Also, contrast sensitivity for sine-wave gratings at all measured frequencies was better, as predicted, for all young adults. Maximum sensitivities in the radial frequency contrast sensitivity function and contrast sensitivity function occurred at 0.25 and 0.5 cycles per degree, respectively, for both young and older adults. These results suggest age-related changes in the contrast sensitivity function for concentric symmetrical stimuli.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Heart failure is a common endpoint for many forms of cardiovascular disease and a significant cause of morbidity and mortality. Chronic neurohumoral excitation (i.e., sympathetic hyperactivity) has been considered to be a hallmark of heart failure and is associated with a poor prognosis, cardiac dysfunction and remodeling, and skeletal myopathy. Aerobic exercise training is efficient in counteracting sympathetic hyperactivity and its toxic effects on cardiac and skeletal muscles. In this review, we describe the effects of aerobic exercise training on sympathetic hyperactivity, skeletal myopathy, as well as cardiac function and remodeling in human and animal heart failure. We also discuss the mechanisms underlying the effects of aerobic exercise training.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this study is to propose a stochastic model for commodity markets linked with the Burgers equation from fluid dynamics. We construct a stochastic particles method for commodity markets, in which particles represent market participants. A discontinuity in the model is included through an interacting kernel equal to the Heaviside function and its link with the Burgers equation is given. The Burgers equation and the connection of this model with stochastic differential equations are also studied. Further, based on the law of large numbers, we prove the convergence, for large N, of a system of stochastic differential equations describing the evolution of the prices of N traders to a deterministic partial differential equation of Burgers type. Numerical experiments highlight the success of the new proposal in modeling some commodity markets, and this is confirmed by the ability of the model to reproduce price spikes when their effects occur in a sufficiently long period of time.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Le récepteur DcR3 (Decoy receptor 3) est un membre de la famille des récepteurs aux facteurs de nécrose tumorale (TNF). Il est fortement exprimé dans les tissus humains normaux ainsi que les tumeurs malignes. DcR3 est un récepteur pour trois ligands de la famille du TNF tels que FasL, LIGHT et TL1A. Étant une protéine soluble donc dépourvue de la portion transmembranaire et intracytoplasmique, le récepteur DcR3 est incapable d’effectuer une transduction de signal intracellulaire à la suite de son interaction avec ses ligands. De ce fait, DcR3 joue un rôle de compétiteur pour ces derniers, afin d’inhiber la signalisation via leurs récepteurs fonctionnels tels que Fas, HVEM/LTbetaR et DR3. Lors de nos précédentes études, nous avons pu démontrer, que DcR3 pouvaist moduler la fonction des cellules immunitaires, et aussi protéger la viabilité des îlots de Langerhans. À la suite de ces résultats, nous avons généré des souris DcR3 transgéniques (Tg) en utilisant le promoteur du gène β-actine humaine afin d’étudier plus amplement la fonction de ce récepteur. Les souris Tg DcR3 ont finalement développé le syndrome lupus-like (SLE) seulement après l’âge de 6 mois. Ces souris présentent une variété d'auto-anticorps comprenant des anticorps anti-noyaux et anti-ADN. Elles ont également manifesté des lésions rénales, cutanées, hépatiques et hématopoïétiques. Contrairement aux modèles de lupus murin lpr et gld, les souris DcR3 sont plus proche du SLE humain en terme de réponse immunitaire de type Th2 et de production d'anticorps d'anti-Sm. En péus, nous avons constaté que les cellules hématopoïétiques produisant DcR3 sont suffisantes pour causer ces pathologies. DcR3 peut agir en perturbant l’homéostasie des cellules T pour interférer avec la tolérance périphérique, et ainsi induire l'autoimmunité. Chez l'humain, nous avons détecté dans le sérum de patients SLE des niveaux élevés de la protéine DcR3. Chez certains patients, comme chez la souris, ces niveaux sont liés directement aux titres élevés d’IgE. Par conséquent, DcR3 peut représenter un facteur pathogénique important du SLE humain. L’étude des souris Tg DcR3, nous a permis aussi d’élucider le mécanisme de protection des îlots de Langerhans. Le blocage de la signalisation des ligands LIGHT et TL1A par DcR3 est impliqué dans une telle protection. D'ailleurs, nous avons identifié par ARN microarray quelques molécules en aval de cette interaction, qui peuvent jouer un rôle dans le mécanisme d’action. Nous avons par la suite confirmé que Adcyap1 et Bank1 joue un rôle critique dans la protection des îlots de Langerhans médiée par DcR3. Notre étude a ainsi élucidé le lien qui existe entre la signalisation apoptotique médiée par Fas/FasL et la pathogénèse du SLE humain. Donc, malgré l’absence de mutations génétiques sur Fas et FasL dans le cas de cette pathologie, DcR3 est capable de beoquer cette signalisation et provoquer le SLE chez l’humain. Ainsi, DcR3 peut simultanément interférer avec la signalisation des ligands LIGHT et TL1A et causer un phénotype plus complexe que les phénotypes résultant de la mutation de Fas ou de FasL chez certains patients. DcR3 peut également être utilisé comme paramètre diagnostique potentiel pour le SLE. Les découvertes du mécanisme de protection des îlots de Langerhans par DcR3 ouvrent la porte vers de nouveaux horizons afin d'explorer de nouvelles cibles thérapeutiques pour protéger la greffe d'îlots.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The attached file is created with Scientific Workplace Latex

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Le clade Dialiinae représente l’une des premières lignées de la sous-famille Caesalpinioideae des Leguminosae. Il se compose de 17 genres (environ 90 espèces), avec des taxons qui sont répandus dans toutes les régions tropicales du monde. Morphologiquement, le groupe comprend un assemblage divers de taxons qui peut représenter une «phase expérimentale» dans l’évolution florale des légumineuses. Différents représentants du clade présentent de la poly-, mono-, et asymétrie, et semblent avoir subi un haut degré de perte d’organe, produisant, dans certains cas, des fleurs extrêmement réduites qui sont à peine reconnaissables comme appartenant à la famille des légumineuses. Afin d’obtenir une image plus claire de l’évolution florale du clade Dialiinae, une phylogénie bien résolue et bien soutenue est nécessaire. Dans le but de créer une telle phylogénie, un total de 37 échantillons d’ADN des Dialiinae a été séquencé pour deux régions chloroplastiques, soit rps16 et trnL. De plus, une étude morphologique complète a été réalisée. Un total de 135 caractères végétatifs et reproductifs a été évalué pour 79 espèces de Dialiinae et pour quatre groupes externes. Les analyses phylogénétiques ont d’abord été effectuées sur un groupe restreint de taxons pour lesquels les trois types de données étaient disponibles. Les nœuds fortement soutenus de cette phylogénie ont ensuite été utilisés comme contrainte pour une seconde analyse de parcimonie avec les données morphologiques d’un ensemble plus important de taxons. Les caractères morphologiques ont été optimisés sur l’un des arbres les plus parcimonieux de cette seconde analyse. Un certain nombre de nouvelles relations au niveau de l’espèce ont été résolues, créant une image plus claire quant à l’évolution de la forme florale dans le temps, particulièrement pour les genres Labichea et Dialium. En plus de leur morphologie florale mature diverse, les Dialiinae sont également très variables dans leur ontogénèse florale, affichant à la fois la perte et la suppression des organes, et présentant une variété de modes d’initiation d’organes. Afin de construire une image plus complète du développement floral et de l’évolution dans ce clade, l’ontogénèse florale de plusieurs espèces non documentées à ce jour a été étudiée. La série complète du développement a été compilée pour six espèces de Dialiinae; quatre de Dialium, ainsi que Poeppigia procera et Mendoravia dumaziana. Le mode et le moment de l’initiation des organes étaient pour la plupart uniforme pour toutes les espèces de Dialium étudiés. Tant pour ce qui est des gains ou des pertes d’organes chez Dialium, une tendance est apparente – l’absence d’organe abaxial. Que ce soit pour les sépales ou les étamines, les gains se produisent toujours en position médiane adaxiale, tandis que les étamines et les pétales perdus sont toujours les organes les plus ventraux. Les taxons étudiés ici illustrent le manque apparent de canalisation du développement observé chez les Caesalpinioideae. Cette plasticité ontogénétique est le reflet de la diversité morphologique au niveau des fleurs tel qu’observée dans l’ensemble de la sous-famille. Une des espèces de Dialiinae, Apuleia leiocarpa, produit une inflorescence andromonoïque, une caractéristique qui est unique en son clade et rare dans les légumineuses dans son ensemble. La microscopie optique et électronique ont été utilisées pour entreprendre une étude détaillée de la morphologie florale de ce taxon. On a constaté que tandis que les fleurs hermaphrodites produisent un seul carpelle et deux étamines, les fleurs staminées produisent trois étamines sans toutefois montrer signe de développement du carpelle. Les inflorescences semblent produire près de quatre fois plus de fleurs staminées que de fleurs hermaphrodites, lesquelles occupent toujours la position centrale de l’inflorescence cymeuse. Ce ratio élevé mâle/bisexuel et la détermination précoce du sexe chez Apuleia sont rares chez les Caesalpinioideae, ce qui suggère que l’andromonoecie se développe dans ce genre comme un moyen d’accroître la dispersion du pollen plutôt qu’en réponse à des limitations de ressources.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This is an attempt to understand the important factors that control the occurrence, development and hydrochemical evolution of groundwater resources in sedimentary multi aquifer systems. The primary objective of this work is an integrated study of the hydrogeology and hydrochemistry with a view to elucidate the hydrochemical evolution of groundwater resources in the aquifer systems. The study is taken up in a typical coastal sedimentary aquifer system evolved under fluvio-marine environment in the coastal area of Kerala, known as the Kuttanad. The present study has been carried out to understand the aquifer systems, their inter relationships and evolution in the Kuttanad area of Kerala. The multi aquifer systems in the Kuttanad basin were formed from the sediments deposited under fluvio-marine and fluvial depositional environments and the marine transgressions and regressions in the geological past and palaeo climatic conditions influenced the hydrochemical environment in these aquifers. The evolution of groundwater and the hydrochemical processes involved in the formation of the present day water quality are elucidated from hydrochemical studies and the information derived from the aquifer geometry and hydraulic properties. Kuttanad area comprises of three types of aquifer systems namely phreatic aquifer underlain by Recent confined aquifer followed by Tertiary confined aquifers. These systems were formed by the deposition of sediments under fluvio-marine and fluvial environment. The study of the hydrochemical and hydraulic properties of the three aquifer systems proved that these three systems are separate entities. The phreatic aquifers in the area have low hydraulic gradients and high rejected recharge. The Recent confined aquifer has very poor hydraulic characteristics and recharge to this aquifer is very low. The Tertiary aquifer system is the most potential fresh water aquifer system in the area and the groundwater flow in the aquifer is converging towards the central part of the study area (Alleppey town) due to large scale pumping of water for water supply from this aquifer system. Mixing of waters and anthropogenic interferences are the dominant processes modifying the hydrochemistry in phreatic aquifers. Whereas, leaching of salts and cation exchange are the dominant processes modifying the hydrochemistry of groundwater in the confined aquifer system of Recent alluvium. Two significant chemical reactions modifying the hydrochemistry in the Recent aquifers are oxidation of iron in ferruginous clays which contributes hydrogen ions and the decomposition of organic matter in the aquifer system which consumes hydrogen ions. The hydrochemical environment is entirely different in the Tertiary aquifers as the groundwater in this aquifer system are palaeo waters evolved during various marine transgressions and regressions and these waters are being modified by processes of leaching of salts, cation exchange and chemical reactions under strong reducing environment. It is proved that the salinity observed in the groundwaters of Tertiary aquifers are not due to seawater mixing or intrusion, but due to dissolution of salts from the clay formations and ion exchange processes. Fluoride contamination in this aquifer system lacks a regional pattern and is more or less site specific in natureThe lowering of piezometric heads in the Tertiary aquifer system has developed as consequence of large scale pumping over a long period. Hence, puping from this aquifer system is to be regulated as a groundwater management strategy. Pumping from the Tertiary aquifers with high capacity pumps leads to well failures and mixing of saline water from the brackish zones. Such mixing zones are noticed from the hydrochemical studies. This is the major aquifer contamination in the Tertiary aquifer system which requires immediate attention. Usage of pumps above 10 HP capacities in wells taping Tertiary aquifers should be discouraged for sustainable development of these aquifers. The recharge areas need to be identified precisely for recharging the aquifer systems throughartificial means.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

El marcaje de proteínas con ubiquitina, conocido como ubiquitinación, cumple diferentes funciones que incluyen la regulación de varios procesos celulares, tales como: la degradación de proteínas por medio del proteosoma, la reparación del ADN, la señalización mediada por receptores de membrana, y la endocitosis, entre otras (1). Las moléculas de ubiquitina pueden ser removidas de sus sustratos gracias a la acción de un gran grupo de proteasas, llamadas enzimas deubiquitinizantes (DUBs) (2). Las DUBs son esenciales para la manutención de la homeostasis de la ubiquitina y para la regulación del estado de ubiquitinación de diferentes sustratos. El gran número y la diversidad de DUBs descritas refleja tanto su especificidad como su utilización para regular un amplio espectro de sustratos y vías celulares. Aunque muchas DUBs han sido estudiadas a profundidad, actualmente se desconocen los sustratos y las funciones biológicas de la mayoría de ellas. En este trabajo se investigaron las funciones de las DUBs: USP19, USP4 y UCH-L1. Utilizando varias técnicas de biología molecular y celular se encontró que: i) USP19 es regulada por las ubiquitin ligasas SIAH1 y SIAH2 ii) USP19 es importante para regular HIF-1α, un factor de transcripción clave en la respuesta celular a hipoxia, iii) USP4 interactúa con el proteosoma, iv) La quimera mCherry-UCH-L1 reproduce parcialmente los fenotipos que nuestro grupo ha descrito previamente al usar otros constructos de la misma enzima, y v) UCH-L1 promueve la internalización de la bacteria Yersinia pseudotuberculosis.