973 resultados para Prostatic Specific Antigen


Relevância:

30.00% 30.00%

Publicador:

Resumo:

B cells mediate immune responses via the secretion of antibody and interactions with other immune cell populations through antigen presentation, costimulation, and cytokine secretion. Although B cells are primarily believed to promote immune responses using the mechanisms described above, some unique regulatory B cell populations that negatively influence inflammation have also been described. Among these is a rare interleukin (IL)-10-producing B lymphocyte subset termed “B10 cells.” B cell-derived IL-10 can inhibit various arms of the immune system, including polarization of Th1/Th2 cell subsets, antigen presentation and cytokine production by monocytes and macrophages, and activation of regulatory T cells. Further studies in numerous autoimmune and inflammatory models of disease have confirmed the ability of B10 cells to negatively regulate inflammation in an IL-10-dependent manner. Although IL-10 is indispensable to the effector functions of B10 cells, how this specialized B cell population is selected in vivo to produce IL-10 is unknown. Some studies have demonstrated a link between B cell receptor (BCR)-derived signals and the acquisition of IL-10 competence. Additionally, whether antigen-BCR interactions are required for B cell IL-10 production during homeostasis as well as active immune responses is a matter of debate. Therefore, the goal of this thesis is to determine the importance of antigen-driven signals during B10 cell development in vivo and during B10 cell-mediated immunosuppression.

Chapter 3 of the dissertation explored the BCR repertoire of spleen and peritoneal cavity B10 cells using single-cell sequencing to lay the foundation for studies to understand the full range of antigens that may be involved in B10 cell selection. In both the spleen and peritoneal cavity B10 cells studied, BCR gene utilization was diverse, and the expressed BCR transcripts were largely unmutated. Thus, B10 cells are likely capable of responding to a wide range of foreign and self-antigens in vivo.

Studies in Chapter 4 determined the predominant antigens that drive B cell IL-10 secretion during homeostasis. A novel in vitro B cell expansion system was used to isolate B cells actively expressing IL-10 in vivo and probe the reactivities of their secreted monoclonal antibodies. B10 cells were found to produce polyreactive antibodies that bound multiple self-antigens. Therefore, in the absence of overarching active immune responses, B cell IL-10 is secreted following interactions with self-antigens.

Chapter 5 of this dissertation investigated whether foreign antigens are capable of driving B10 cell expansion and effector activity during an active immune response. In a model of contact-induced hypersensitivity, in vitro B cell expansion was again used to isolate antigen-specific B10 clones, which were required for optimal immunosuppression.

The studies described in this dissertation shed light on the relative contributions of BCR-derived signals during B10 cell development and effector function. Furthermore, these investigations demonstrate that B10 cells respond to both foreign and self-antigens, which has important implications for the potential manipulation of B10 cells for human therapy. Therefore, B10 cells represent a polyreactive B cell population that provides antigen-specific regulation of immune responses via the production of IL-10.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The schistosome blood flukes are some of the largest global causes of parasitic morbidity. Further study of the specific antibody response during schistosomiasis may yield the vaccines and diagnostics needed to combat this disease. Therefore, for the purposes of antigen discovery, sera and antibody-secreting cell (ASC) probes from semi-permissive rats and sera from susceptible mice were used to screen a schistosome protein microarray. Following Schistosoma japonicum infection, rats had reduced pathology, increased antibody responses and broader antigen recognition profiles compared with mice. With successive infections, rat global serological reactivity and the number of recognized antigens increased. The local antibody response in rat skin and lung, measured with ASC probes, increased after parasite migration and contributed antigen-specific antibodies to the multivalent serological response. In addition, the temporal variation of anti-parasite serum antibodies after infection and reinfection followed patterns that appear related to the antigen driving the response. Among the 29 antigens differentially recognized by the infected hosts were numerous known vaccine candidates, drug targets and several S. japonicum homologs of human schistosomiasis resistance markers-the tegument allergen-like proteins. From this set, we prioritized eight proteins that may prove to be novel schistosome vaccine and diagnostic antigens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Although anti−cancer immuno−based combinatorial therapeutic approaches have shown promising results, efficient tumour eradication demands further intensification of anti−tumour immune response. With the emerging field of nanovaccinology, multi−walled carbon nanotubes (MWNTs) have manifested prominent potentials as tumour antigen nanocarriers. Nevertheless, the utilization of MWNTs in co−delivering antigen along with different types of immunoadjuvants to antigen presenting cells (APCs) has not been investigated yet. We hypothesized that harnessing MWNT for concurrent delivery of cytosine−phosphate−guanine oligodeoxynucleotide (CpG) and anti-CD40 Ig (αCD40), as immunoadjuvants, along with the model antigen ovalbumin (OVA) could potentiate immune response induced against OVA−expressing tumour cells. We initially investigated the effective method to co−deliver OVA and CpG using MWNT to the APC. Covalent conjugation of OVA and CpG prior to loading onto MWNTs markedly augmented the CpG−mediated adjuvanticity, as demonstrated by the significantly increased OVA−specific T cell responses in vitro and in C57BL/6 mice. αCD40 was then included as a second immunoadjuvant to further intensify the immune response. Immune response elicited in vitro and in vivo by OVA, CpG and αCD40 was significantly potentiated by their co−incorporation onto the MWNTs. Furthermore, MWNT remarkably improved the ability of co−loaded OVA, CpG and αCD40 in inhibiting the growth of OVA−expressing B16F10 melanoma cells in subcutaneous or lung pseudo−metastatic tumour models. Therefore, this study suggests that the utilization of MWNTs for the co−delivery of tumour−derived antigen, CpG and αCD40 could be a competent approach for efficient tumours eradication.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Occult hepatitis B infections are becoming a major global threat, but the available data on its prevalence in various parts of the world are often divergent. Objective: This study aimed to detect occult hepatitis B virus in hepatitis B surface antigen-negative serum using anti-HBc as a marker of previous infection. Patient and Methods: A total of 1000 randomly selected hepatitis B surface antigen-negative sera from blood donors were tested for hepatitis B core antibody and hepatitis B surface antibody using an ELISA and nested polymerase chain reaction was done using primers specific to the surface gene (S-gene). Results: Of the 1000 samples 55 (5.5%) were found to be reactive, of which 87.3% (48/55) were positive for hepatitis B surface antibody, indicating immunity as a result of previous infection however, that does not exclude active infection with escaped mutant HBV. Nested PCR results showed the presence of hepatitis B viral DNA in all the 55 samples that were positive for core protein, which is in agreement with the hepatitis B surface antibody result. Conclusion: This study reveals the 5.5% prevalence of occult hepatitis B among Malaysian blood donors as well as the reliability of using hepatitis B core antibody in screening for occult hepatitis B infection in low endemic, low socioeconomic settings.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Inflammatory bowel disease (IBD) is a chronic inflammation which affects the gastrointestinal tract (GIT). One of the best ways to study the immunological mechanisms involved during the disease is the T cell transfer model of colitis. In this model, immunodeficient mice (RAG-/-recipients) are reconstituted with naive CD4+ T cells from healthy wild type hosts. This model allows examination of the earliest immunological events leading to disease and chronic inflammation, when the gut inflammation perpetuates but does not depend on a defined antigen. To study the potential role of antigen presenting cells (APCs) in the disease process, it is helpful to have an antigen-driven disease model, in which a defined commensal-derived antigen leads to colitis. An antigen driven-colitis model has hence been developed. In this model OT-II CD4+ T cells, that can recognize only specific epitopes in the OVA protein, are transferred into RAG-/- hosts challenged with CFP-OVA-expressing E. coli. This model allows the examination of interactions between APCs and T cells in the lamina propria.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background. Benign prostatic hyperplasia (BPH) pharmacological treatment may promote a decrease in prostate vascularization and bladder neck relaxation with theoretical improvement in prostate biopsy morbidity, though never explored in the literature. Methods. Among 242 consecutive unselected patients who underwent prostate biopsy, after excluding those with history of prostate biopsy/surgery or using medications not for BPH, we studied 190 patients. On the 15th day after procedure patients were questioned about symptoms lasting over a week and classified according to pharmacological BPH treatment. Results. Thirty-three patients (17%) were using alpha-blocker exclusively, five (3%) 5-alpha-reductase inhibitor exclusively, twelve (6%) patients used both medications, and 140 (74%) patients used none. There was no difference in regard to age among groups (P = 0.5). Postbiopsy adverse effects occurred as follows: hematuria 96 (50%), hematospermia 53 (28%), hematochezia 22 (12%), urethrorrhagia 19 (10%), fever 5 (3%), and pain 20 (10%). There was a significant negative correlation between postbiopsy hematuria and BPH pharmacological treatment with stronger correlation for combined use of 5-alpha-reductase inhibitor and alpha-blocker over 6 months (P = 0.0027). Conclusion. BPH pharmacological treatment, mainly combined for at least 6 months seems to protect against prostate biopsy adverse effects. Future studies are necessary to confirm our novel results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic phospholipases A2 (PLA2) are toxic and induce a wide spectrum of pharmacological effects, although the acidic enzyme types are not lethal or cause low lethality. Therefore, it is challenging to elucidate the mechanism of action of acidic phospholipases. This study used the acidic non-toxic Ba SpII RP4 PLA2 from Bothrops alternatus as an antigen to develop anti-PLA2 IgG antibodies in rabbits and used in vivo assays to examine the changes in crude venom when pre-incubated with these antibodies. Using Ouchterlony and western blot analyses on B. alternatus venom, we examined the specificity and sensitivity of phospholipase A2 recognition by the specific antibodies (anti-PLA2 IgG). Neutralisation assays using a non-toxic PLA2 antigen revealed unexpected results. The (indirect) haemolytic activity of whole venom was completely inhibited, and all catalytically active phospholipases A2 were blocked. Myotoxicity and lethality were reduced when the crude venom was pre-incubated with anti-PLA2 immunoglobulins. CK levels in the skeletal muscle were significantly reduced at 6 h, and the muscular damage was more significant at this time-point compared to 3 and 12 h. When four times the LD50 was used (224 μg), half the animals treated with the venom-anti PLA2 IgG mixture survived after 48 h. All assays performed with the specific antibodies revealed that Ba SpII RP4 PLA2 had a synergistic effect on whole-venom toxicity. IgG antibodies against the venom of the Argentinean species B. alternatus represent a valuable tool for elucidation of the roles of acidic PLA2 that appear to have purely digestive roles and for further studies on immunotherapy and snake envenoming in affected areas in Argentina and Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aging is considered one of the main predisposing factors for the development of prostate malignancies. Angiogenesis is fundamental for tumor growth and its inhibition represents a promising therapeutic approach in cancer treatment. Thus, we sought to determine angiogenic responses and the effects of antiangiogenic therapy in the mouse prostate during late life, comparing these findings with the prostatic microenvironment in the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. Male mice (52 week-old FVB) were submitted to treatments with SU5416 (6 mg/kg; i.p.) and/or TNP-470 (15 mg/kg; s.c.). Finasteride was administered (20 mg/kg; s.c.), alone or in association to both inhibitors. The dorsolateral prostate was collected for VEGF, HIF-1α, FGF-2 and endostatin immunohistochemical and Western Blotting analyses and for microvessel density (MVD) count. Senescence led to increased MVD and VEGF, HIF-1α and FGF-2 protein levels in the prostatic microenvironment, similarly to what was observed in TRAMP mice prostate. The angiogenic process was impaired in all the treated groups, demonstrating significantly decreased MVD. Antiangiogenic and/or finasteride treatments resulted in decreased VEGF and HIF-1α levels, especially following TNP-470 administration, either alone or associated to SU5416. The combination of these agents resulted in increased endostatin levels, regardless of the presence of finasteride. Prostatic angiogenesis stimulation during senescence favored the development of neoplastic lesions, considering the pro-angiogenic microenvironment as a common aspect also observed during cancer progression in TRAMP mice. The combined antiangiogenic therapy was more efficient, leading to enhanced imbalance towards angiogenic inhibition in the organ. Finally, finasteride administration might secondarily upregulate the expression of pro-angiogenic factors, pointing to the harmful effects of this therapy. Prostate 75: 484-499, 2015. © 2014 Wiley Periodicals, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.