994 resultados para PID-control
Resumo:
Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.
Resumo:
Polycyclic aromatic hydrocarbons (PAHs) are a group of compounds that have been the subject of much concern due to their toxic potential. In this study, margarine?s, vegetable cream and mayonnaise available on the Brazilian market were analyzed for pyrene, chrysene, benzo(a)pyrene, benzo(b)fluoranthene and dibenzo(a,h)anthracene. The analytical methodology involved liquid-liquid extraction, clean-up on silica gel column and determination by high performance liquid chromatography using fluorescence detector. Variable levels of contamination were found within differents brands of the same product and within differents batches of the same brand. The total PAH content was in the range of 4.1 to 7.1mug/kg in vegetable cream, 1.7 to 3.9mug/kg in margarine and 1.0 to 21.7mug/kg in mayonnaise. In general the products which according to the label contain corn oil showed the highest levels of contamination. Based on these results and on the importance of fat, oils and derived products for the intake of PAHs, it is recommended that producers of margarine, vegetable creams and mayonnaise start to control the contamination of the vegetable oils used in the elaboration of these products, in order to reduce the exposure of consumers to excessive amounts of potentially carcinogenic compounds.
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To evaluate the growth and body composition of children and adolescents with type 1 diabetes mellitus (T1DM). SUBJECTS AND METHODS: A cohort of 44 patients with T1DM were followed up for approximately four years and compared with a control group. Weight, height, body mass index (BMI), body fat percentage (BF%), fat mass index, waist circumference (WC) and waist-height ratio were determined. RESULTS: In females, in the first evaluation, BF% was lower in patients than in controls, while in the second evaluation, mean WC was higher in patients than in controls. In males, height of the patients was lower in the first evaluation, while body mass index (BMI) was higher in the second one. We did not find any differences among the changes in height, weight and BMI z-scores and BF% or in the distribution of those z-scores between the two evaluations, in both groups. Multiple regression analysis found differences in BMI and waist-height ratio in both sexes and also in WC in females. CONCLUSION: The patients had adequate growth but showed discrepancy in their body composition during the study.
Resumo:
Purpose: To analyze the efficacy and safety of intraope-rative mitomycin C (MMC) in combined procedures (extra-capsular cataract extraction + trabeculectomy). Methods: Twenty-four patients were randomized to either MMC (0.5 mg/ml) (n = 14) or saline solution (n = 10) for 3 minutes during the combined procedure. Results: Twelve months after surgery, mean IOP in the MMC group (13.2 ± 2.9 mmHg) was significantly lower than in the control group (16.3 ± 3.9 mmHg) (p = 0.02). The mean number of medications used during the 12-month follow-up in the control group (1.33 ± 0.5) was significantly higher than in the MMC-treated group (0.5 ± 0.5) (p = 0.005). Life table analysis showed a significantly higher probability of IOP control in the MMC group than in the control group (p < 0.01). Conclusions: Intraoperative MMC is safe and effective in pro-moting a better IOP control and reducing the need for postoperative antiglaucoma medications. We suggest intraope-rative MMC to be routinely employed in combined procedures.
Resumo:
PURPOSE: To collect information and opinions from a group of diabetic patients regarding diabetic retinopathy and its treatment, in order to get reliable information that can help to improve programs and actions to control and prevent this ocular disease. METHODS: A cross-sectional study was performed. The sample was from 980 diabetic patients seen in a diabetic association. A previous questionnaire was made with general questions about the main subject. Thereafter, an appropriate questionnaire was prepared. RESULTS: The sample showed that among 299 patients with age ranging from 16 to 83 years, with a mean of 57 years, mainly female (67.91%) did not know how severe their disease was (30.8%), or believed that it was not a serious problem (19.7%). The laser technique to solve diabetic retinopathy was known by 60.2% of the patients. It was reported as the only treatment available by 24.1%. Among the reasons for no treatment 59.8% reported that they did not think it was necessary and 29.7% could not afford it. CONCLUSIONS: Patients showed lack of knowledge about how serious is diabetic retinopathy, the possibility of using laser technique for it and the severity of the disease. Some patients believed in the efficacy of the treatment and some patients did not, but all of them reported that they were afraid of submitting to it.
Resumo:
PURPOSES: 1) To verify the impact of the creation of the Single Technical Record (STR) at the University of Campinas (Unicamp) Hospital das Clínicas, on the preservation period of corneas which were used in elective penetrating keratoplasties, and 2) to compare the primary failure incidence in cornea penetrating keratoplasties regarding the periods before and after the creation of STR. METHODS: A retrospective study was conducted at the Unicamp Hospital, which evaluated 15 consecutive cornea penetrating keratoplasties between January 1st and April 30th, 2000 and 24 consecutive penetrating keratoplasties between May 1st and September 20th of the same year (corneas under the control of the STR), totaling 39 keratoplasties. RESULTS: The mean time between cornea preparation and transplantation was 3.8 days (±1.78) in the period before STR creation, and 6.0 days (±2.97) after STR creation, representing a 36.7% increase in the preservation time. There was a statistically significant difference (p=0.02) between the two groups. No corneal primary failure was observed among the 39 transplanted patients in both groups. CONCLUSION: Based on the results of this study, it can be concluded that this new concept of the State Transplantation System has caused a statistically significant increase in the conservation period of corneas, which may reduce the period of a clear transplant due to an increased loss of endothelial cells, as well as increase the primary failure incidence or result in a high number of corneas that cannot be used due to having exceeded the preservation time recommended by the literature.
Resumo:
Purpose: This study aimed to evaluate the assistance quality through the perception of the users and municipal health managers (mayors, health secretaries and screening team). Methods: A transversal and descriptive study was carried out. Results: The sample was comprised by 359 users and 48 managers. Medical assistance was considered excellent by 79.6% of the users, 93.7% of the managers, 87.5% of the health secretaries and 100% of the screening team. Reception received a great evaluation by 73.8% of the users and 93.8% of the selectors. Conclusion: The assistance model used at the Ophthalmologic Clinic of Divinolândia obtained a high level of satisfaction pleasing both users and managers.
Resumo:
PURPOSE: To compare clinical trials published in Brazilian journals of ophthalmology and in foreign journals of ophthalmology with respect to the number of citations and the quality of reporting [by applying the Consolidated Standards for Reporting Trials (CONSORT) statement writing standards]. METHODS: The sample of this systematic review comprised the two Brazilian journals of ophthalmology indexed at Science Citation Index Expanded and six of the foreign journals of ophthalmology with highest Impact Factor® according ISI. All clinical trials (CTs) published from January 2009 to December 2010 at the Brazilians journals and a 1:1 randomized sample of the foreign journals were included. The primary outcome was the number of citations through the end of 2011. Subgroup analysis included language. The secondary outcome included likelihood of citation (cited at least once versus no citation), and presence or absence of CONSORT statement indicators. RESULTS: The citation counts were statistically significantly higher (P<0.001) in the Foreign Group (10.50) compared with the Brazilian Group (0.45). The likelihood citation was statistically significantly higher (P<0.001) in the Foreign Group (20/20 - 100%) compared with the Brazilian Group (8/20 - 40%). The subgroup analysis of the language influence in Brazilian articles showed that the citation counts were statistically significantly higher in the papers published in English (P<0.04). Of 37 possible CONSORT items, the mean for the Foreign Group was 20.55 and for the Brazilian Group was 13.65 (P<0.003). CONCLUSION: The number of citations and the quality of reporting of clinical trials in Brazilian journals of ophthalmology still are low when compared with the foreign journals of ophthalmology with highest Impact Factor®.
Resumo:
PURPOSE: To evaluate the ocular surface toxicity of two nitric oxide donors in ex vivo and in vivo animal models: S-nitrosoglutathione (GSNO) and S-nitroso-N-acetylcysteine (SNAC) in a hydroxypropyl methylcellulose (HPMC) matrix at final concentrations 1.0 and 10.0 mM. METHODS: Ex vivo GSNO and SNAC toxicities were clinically and histologically analyzed using freshly excised pig eyeballs. In vivo experiments were performed with 20 albino rabbits which were randomized into 4 groups (5 animals each): Groups 1 and 2 received instillations of 150 µL of aqueous HPMC solution containing GSNO 1.0 and 10.0 mM, respectively, in one of the eyes; Groups 3 and 4 received instillations of 150 µL of aqueous HPMC solution-containing SNAC 1.0 and 10.0 mM, respectively, in one of the eyes. The contralateral eyes in each group received aqueous HPMC as a control. All animals underwent clinical evaluation on a slit lamp and the eyes were scored according to a modified Draize eye test and were histologically analyzed. RESULTS: Pig eyeballs showed no signs of perforation, erosion, corneal opacity or other gross damage. These findings were confirmed by histological analysis. There was no difference between control and treated rabbit eyes according to the Draize eye test score in all groups (p>0.05). All formulations showed a mean score under 1 and were classified as non-irritating. There was no evidence of tissue toxicity in the histological analysis in all animals. CONCLUSION: Aqueous HPMC solutions containing GSNO and SNAC at concentrations up to 10.0 mM do not induce ocular irritation.
Resumo:
OBJETIVO: o objetivo deste estudo foi avaliar os efeitos esqueléticos e dentoalveolares do tratamento de pacientes com má oclusão de Classe II com o aparelho Jasper Jumper associado ao aparelho ortodôntico fixo, comparados a um grupo controle não-tratado. MÉTODOS: a amostra foi constituída por 47 indivíduos, divididos em dois grupos: Grupo 1, contendo 25 pacientes com idade média de 12,72 anos, tratados com o aparelho Jasper Jumper por um tempo médio de 2,15 anos; Grupo 2 (controle), composto por 22 indivíduos com idade média de 12,67 anos, não-submetidos a tratamento ortodôntico e com má oclusão de Classe II, observados por um período médio de 2,12 anos. Foram avaliadas as telerradiografias ao início e ao final do tratamento ortodôntico para o Grupo 1 e do período de observação para o Grupo 2. As variáveis cefalométricas iniciais, finais e as alterações com o tratamento foram comparadas entre os grupos por meio do teste t independente. RESULTADOS: em comparação ao grupo controle, o grupo Jasper Jumper apresentou maior restrição do deslocamento anterior da maxila e maior retrusão maxilar, melhora da relação maxilomandibular, diminuição da convexidade facial, maior protrusão e intrusão dos incisivos inferiores e maior extrusão dos molares inferiores, além de maior diminuição dos trespasses horizontal e vertical e maior melhora da relação molar. CONCLUSÃO: a correção da Classe II no grupo tratado com o Jasper Jumper e aparelhagem fixa se deu principalmente devido à restrição do crescimento maxilar, protrusão e intrusão dos incisivos inferiores e extrusão dos molares inferiores.
Resumo:
The purpose of this study was to evaluate the clinical performance of glass ionomer cement (GIC) restorations comparing two minimally invasive methods in permanent teeth after 12 months. Fifty pregnant women (second trimester of pregnancy), mean age 22 ± 5.30 years, were treated by two previously trained operators. The treatment approaches tested were: chemomechanical method (CarisolvTM; MediTeam) and atraumatic restorative treatment (ART). A split-mouth study design was used in which the two treatments were randomly placed in 50 matched pairs of permanent teeth. The chemomechanical method (CM) was the test group and the ART was the control group. The treatments were performed in Public Health Centers. The tested restorative material was a high-strength GIC (Ketac Molar; 3M/ESPE). The restorations were placed according to the ART guidelines. Two calibrated independent examiners evaluated the restorations in accordance with ART criteria. The inter-examiner kappa was 0.97. Data were analyzed using 95% confidence interval on the binomial distribution and Fisher's exact test at 5% significance level. In a 12-month follow-up, 86% of the restorations were evaluated. In the test group (CM), 100% (CI=93.3-100%) of the restorations were considered successful. In the control group (ART) 97.6% (CI=87.4-99.9%) of the restorations were considered successful and 2.4% unsuccessful (marginal defect >0.5 mm). There was no statistically significant difference between the 12-mounth success rate for both groups (Fisher's exact test: P=0.49) and between the two operators (Fisher's exact test: P=1.00). Both minimally invasive methods, chemomechanical method and ART, showed a similar clinical performance after 12 months of follow up.
Resumo:
INTRODUÇãO: os cirurgiões-dentistas têm a responsabilidade de prevenir doenças, minimizar riscos e promover saúde. Os pacientes também precisam ser despertados sobre o seu papel nos cuidados com a saúde bucal. No caso de pacientes em tratamento ortodôntico, é particularmente difícil manter uma higiene bucal satisfatória devido à presença de bandas, fios e ligaduras. Torna-se, então, indispensável a instituição de métodos preventivos de motivação e orientação para o controle mecânico da placa dentária. OBJETIVO: verificar os efeitos de ações educativas, preventivas e motivacionais sobre a saúde bucal de pacientes em tratamento ortodôntico fixo. MéTODOS: os participantes receberam gratuitamente dentifrício e escova dental durante todo o estudo e instruções sobre higiene bucal foram fornecidas e reforçadas no decorrer dos 6 meses da pesquisa. Foram realizados exames clínicos baseline e após 6, 12 e 24 semanas, para verificação dos índices de Placa, Gengival e Sangramento. RESULTADOS: as condições de saúde bucal dos participantes, que inicialmente eram insatisfatórias, melhoraram significativamente no decorrer do estudo, considerando-se todos os índices. As ações preventivas, educativas e motivacionais realizadas foram estatisticamente eficazes na melhora da saúde bucal dos pacientes ortodônticos. CONCLUSõES: a promoção de saúde e a prevenção de doenças devem fazer parte do atendimento que os ortodontistas direcionam aos seus pacientes, sendo que a orientação e motivação quanto aos cuidados com a saúde bucal devem estar presentes antes e durante o tratamento.