958 resultados para Microbial


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Balsamic vinegar (BV) is a typical and valuable Italian product, worldwide appreciated thanks to its characteristic flavors and potential health benefits. Several studies have been conducted to assess physicochemical and microbial compositions of BV, as well as its beneficial properties. Due to highly-disseminated claims of antioxidant, antihypertensive and antiglycemic properties, BV is a known target for frauds and adulterations. For that matter, product authentication, certifying its origin (region or country) and thus the processing conditions, is becoming a growing concern. Striving for fraud reduction as well as quality and safety assurance, reliable analytical strategies to rapidly evaluate BV quality are very interesting, also from an economical point of view. This work employs silica plate laser desorption/ionization mass spectrometry (SP-LDI-MS) for fast chemical profiling of commercial BV samples with protected geographical indication (PGI) and identification of its adulterated samples with low-priced vinegars, namely apple, alcohol and red/white wines.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Isatin, an indole alkaloid has been shown to have anti-microbial, anti-tumor and anti-inflammatory effects. Due to its findings, we evaluated whether this alkaloid would have any effect on TNBS-induced colitis. Animals (male Unib:WH rats, aged 8 weeks old) were induced colitis through a rectal administration of 2,4,6-trinitrobenzene sulphonic acid using a catheter inserted 8 cm into the rectum of the animals. The rats were divided into two major groups: non-colitic and colitic. The colitic group was sub-divided into 6 groups (10 animals per group): colitic non-treated, Isatin 3; 6; 12.5; 18.75 and 25 mg/kg. Our main results showed that the oral treatment with Isatin 6 and 25 mg/kg were capable of avoiding the increase in TNF-α, COX-2 and PGE₂ levels when compared to the colitic non-treated group. Interestingly, the same doses (6 and 25 mg/kg) were also capable of preventing the decrease in IL-10 levels comparing with the colitic non-treated group. The levels of MPO, (an indirect indicator of neutrophil presence), were also maintained lower than those of the colitic non-treated group. Isatin also prevented the decrease of SOD activity and increase of GSH-Px and GSH-Rd activity as well as the depletion of GSH levels. In conclusion, both pre-treatments (6 and 25 mg/kg) were capable of protecting the gut mucosa against the injury caused by TNBS, through the combination of antioxidant and anti-inflammatory properties, which, together, showed a protective activity of the indole alkaloid Isatin.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organisms<0.4 log CFU/cm(2)). Peracetic acid was the most effective disinfectant, eliminating the multi-species biofilms under all tested conditions (counts of the all microorganisms <0.4 log CFU/cm(2)). In contrast, biguanide was the least effective disinfectant, failing to eliminate biofilms under all the test conditions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The recombinant Rhizopus oryzae lipase (1-3 positional selective), immobilized on Relizyme OD403, has been applied to the production of biodiesel using single cell oil from Candida sp. LEB-M3 growing on glycerol from biodiesel process. The composition of microbial oil is quite similar in terms of saponifiable lipids than olive oil, although with a higher amount of saturated fatty acids. The reaction was carried out in a solvent system, and n-hexane showed the best performance in terms of yield and easy recovery. The strategy selected for acyl acceptor addition was a stepwise methanol addition using crude and neutralized single cell oil, olive oil and oleic acid as substrates. A FAMEs yield of 40.6% was obtained with microbial oils lower than olive oil 54.3%. Finally in terms of stability, only a lost about 30% after 6 reutilizations were achieved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multidrug-resistant microbial infections represent an exponentially growing problem affecting communities worldwide. Photodynamic therapy is a promising treatment based on the combination of light, oxygen, and a photosensitizer that leads to reactive oxygen species production, such as superoxide (type I mechanism) and singlet oxygen (type II mechanism) that cause massive oxidative damage and consequently the host cell death. Indigofera genus has gained considerable interest due its mutagenic, cytotoxic, and genotoxic activity. Therefore, this study was undertaken to investigate the effect of crude extracts, alkaloidal fraction, and isolated substance derived from Indigofera truxillensis in photodynamic antimicrobial chemotherapy on the viability of bacteria and yeast and evaluation of mechanisms involved. Our results showed that all samples resulted in microbial photoactivation in subinhibitory concentration, with indigo alkaloid presenting a predominant photodynamic action through type I mechanism. The use of CaCl2 and MgCl2 as cell permeabilizing additives also increased gram-negative bacteria susceptibility to indigo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present work aimed to investigate the diversity of bacteria and filamentous fungi of southern Atlantic Ocean marine sponge Dragmacidon reticulatum using cultivation-independent approaches. Fungal ITS rDNA and 18S gene analyses (DGGE and direct sequencing approaches) showed the presence of representatives of three order (Polyporales, Malasseziales, and Agaricales) from the phylum Basidiomycota and seven orders belonging to the phylum Ascomycota (Arthoniales, Capnodiales, Dothideales, Eurotiales, Hypocreales, Pleosporales, and Saccharomycetales). On the other hand, bacterial 16S rDNA gene analyses by direct sequencing approach revealed the presence of representatives of seven bacterial phyla (Cyanobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Lentisphaerae, Chloroflexi, and Planctomycetes). Results from statistical analyses (rarefaction curves) suggested that the sampled clones covered the fungal diversity in the sponge samples studied, while for the bacterial community additional sampling would be necessary for saturation. This is the first report related to the molecular analyses of fungal and bacterial communities by cultivation-independent approaches in the marine sponges D. reticulatum. Additionally, the present work broadening the knowledge of microbial diversity associated to marine sponges and reports innovative data on the presence of some fungal genera in marine samples.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Some bacteria common in anaerobic digestion process can ferment a broad variety of organic compounds to organic acids, alcohols, and hydrogen, which can be used as biofuels. Researches are necessary to control the microbial interactions in favor of the alcohol production, as intermediary products of the anaerobic digestion of organic compounds. This paper reports on the effect of buffering capacity on the production of organic acids and alcohols from wastewater by a natural mixed bacterial culture. The hypothesis tested was that the increase of the buffering capacity by supplementation of sodium bicarbonate in the influent results in benefits for alcohol production by anaerobic fermentation of wastewater. When the influent was not supplemented with sodium bicarbonate, the chemical oxygen demand (COD)-ethanol and COD-methanol detected in the effluent corresponded to 22.5 and 12.7 % of the COD-sucrose consumed. Otherwise, when the reactor was fed with influent containing 0.5 g/L of sodium bicarbonate, the COD-ethanol and COD-methanol were effluents that corresponded to 39.2 and 29.6 % of the COD-sucrose consumed. Therefore, the alcohol production by supplementation of the influent with sodium bicarbonate was 33.6 % higher than the fermentation of the influent without sodium bicarbonate.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Isomaltulose, a functional isomer of sucrose, is a non-cariogenic reducing disaccharide; has a low glycemic index; selectively promotes growth of beneficial bifidobacteria in the human intestinal microflora; and has greater stability than sucrose in some foods and beverages. Isomaltulose is a nutritional sugar that is digested more slowly than sucrose, and has health advantages for diabetics and nondiabetics. Immobilization techniques, especially entrapment of the cells, are widely used for conversion of sucrose into isomaltulose. Immobilization offers advantages such as minimum downstream processing, continuous operation and reusability of cells. Isomaltulose is currently considered to be a promising sugar substitute.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Ethanolic extracts from propolis were performed by using lhe water and vaflous coneentrations of etanol as solvent. The extracts were investigated by measurement of absorption spectruin with Uv-spectrophotometer (UV-scanning), reversed phase-high performance thin-layer chromatography, Reversed phase-HPLC. Maximum absorption of ali extracts was 290 nm, resembling flavonoid compounds and 80% ethanolic extract showed highest absorption at 290 nm. The most isosakuranetin, quercefin, and kaempferol were extracted from mixtures of propolis and 60% etanol, whereas 70% etanol extracted te most pinocembrin and sakuranetin, but 80% etanol extracted more kaempferide, acacetin, and isorhamnetin from propolis. The 60 to 80% ethanolic extracts ofpropolis inhibited highly to microbial growth and 70 and 80% ethanolic extracts showed lhe greatest antioxidant activity and 80% ethanolic extract inhibited highly to hyaluronidase activity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: This study evaluated the efficacy of NitrAdineTM-based disinfecting cleaning tablets for complete denture, in terms of denture biofilm removal and antimicrobial action. MATERIAL AND METHODS: Forty complete denture wearers (14 men and 26 women) with a mean age of 62.3±9.0 years were randomly assigned to two groups and were instructed to clean their dentures according to two methods: brushing (control) - 3 times a day with denture brush and tap water following meals; brushing and immersion (Experimental) - brushing the denture 3 times a day with denture brush and tap water following meals and immersion of the denture in NitrAdineTM-based denture tablets (Medical InterporousTM). Each method was used for 21 days. Denture biofilm was disclosed by a 1% neutral red solution and quantified by means of digital photos taken from the internal surface before and after the use of the product. Microbiological assessment was conducted to quantify Candida sp. RESULTS: An independent t-test revealed a significant lower biofilm percentage for the experimental group (4.7, 95% CI 2.4 to 7.9) in comparison with the control group (mean 37.5, 95% CI 28.2 to 48.1) (t38=7.996, p<0.001). A significant reduction of yeast colony forming units could be found after treatment with Medical InterporousTM denture tablets as compared to the control group (Mann-Whitney test, Z=1.90; p<0.05). CONCLUSION: The present findings suggest that NitrAdineTM-based disinfecting cleaning tablets are efficient in removal of denture biofilm. In addition, a clear antimicrobial action was demonstrated. Therefore, they should be recommended as a routine denture maintenance method for the prevention of the development of microbial biofilm induced denture stomatitis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prosthetic restorations that have been tried in the patient's mouth are potential sources of infection. In order to avoid cross-infection, protocols for infection control should be established in dental office and laboratory. This study evaluated the antimicrobial efficacy of disinfectants on full metal crowns contaminated with microorganisms. Full crowns cast in a Ni-Cr alloy were assigned to one control group (n=6) and 5 experimental groups (n=18). The crowns were placed in flat-bottom glass balloons and were autoclaved. A microbial suspension of each type of strain - S. aureus, P. aeruginosa, S. mutans, E. faecalis and C. albicans- was aseptically added to each experimental group, the crowns being allowed for contamination during 30 min. The contaminated specimens were placed into recipients with the chemical disinfectants (1% and 2% sodium hypochlorite and 2% glutaraldehyde) for 5, 10 and 15 min. Thereafter, the crowns were placed into tubes containing different broths and incubated at 35ºC. The control specimens were contaminated, immersed in distilled water for 20 min and cultured in Thioglycollate broth at 35ºC. Microbial growth assay was performed by qualitative visual examination after 48 h, 7 and 12 days. Microbial growth was noticed only in the control group. In the experimental groups, turbidity of the broths was not observed, regardless of the strains and immersion intervals, thus indicating absence of microbial growth. In conclusion, all chemical disinfectants were effective in preventing microbial growth onto full metal crowns.