881 resultados para Large-scale Analysis
Resumo:
In today's fast-paced and interconnected digital world, the data generated by an increasing number of applications is being modeled as dynamic graphs. The graph structure encodes relationships among data items, while the structural changes to the graphs as well as the continuous stream of information produced by the entities in these graphs make them dynamic in nature. Examples include social networks where users post status updates, images, videos, etc.; phone call networks where nodes may send text messages or place phone calls; road traffic networks where the traffic behavior of the road segments changes constantly, and so on. There is a tremendous value in storing, managing, and analyzing such dynamic graphs and deriving meaningful insights in real-time. However, a majority of the work in graph analytics assumes a static setting, and there is a lack of systematic study of the various dynamic scenarios, the complexity they impose on the analysis tasks, and the challenges in building efficient systems that can support such tasks at a large scale. In this dissertation, I design a unified streaming graph data management framework, and develop prototype systems to support increasingly complex tasks on dynamic graphs. In the first part, I focus on the management and querying of distributed graph data. I develop a hybrid replication policy that monitors the read-write frequencies of the nodes to decide dynamically what data to replicate, and whether to do eager or lazy replication in order to minimize network communication and support low-latency querying. In the second part, I study parallel execution of continuous neighborhood-driven aggregates, where each node aggregates the information generated in its neighborhoods. I build my system around the notion of an aggregation overlay graph, a pre-compiled data structure that enables sharing of partial aggregates across different queries, and also allows partial pre-computation of the aggregates to minimize the query latencies and increase throughput. Finally, I extend the framework to support continuous detection and analysis of activity-based subgraphs, where subgraphs could be specified using both graph structure as well as activity conditions on the nodes. The query specification tasks in my system are expressed using a set of active structural primitives, which allows the query evaluator to use a set of novel optimization techniques, thereby achieving high throughput. Overall, in this dissertation, I define and investigate a set of novel tasks on dynamic graphs, design scalable optimization techniques, build prototype systems, and show the effectiveness of the proposed techniques through extensive evaluation using large-scale real and synthetic datasets.
Resumo:
Wind energy is one of the most promising and fast growing sector of energy production. Wind is ecologically friendly and relatively cheap energy resource available for development in practically all corners of the world (where only the wind blows). Today wind power gained broad development in the Scandinavian countries. Three important challenges concerning sustainable development, i.e. energy security, climate change and energy access make a compelling case for large-scale utilization of wind energy. In Finland, according to the climate and energy strategy, accepted in 2008, the total consumption of electricity generated by means of wind farms by 2020, should reach 6 - 7% of total consumption in the country [1]. The main challenges associated with wind energy production are harsh operational conditions that often accompany the turbine operation in the climatic conditions of the north and poor accessibility for maintenance and service. One of the major problems that require a solution is the icing of turbine structures. Icing reduces the performance of wind turbines, which in the conditions of a long cold period, can significantly affect the reliability of power supply. In order to predict and control power performance, the process of ice accretion has to be carefully tracked. There are two ways to detect icing – directly or indirectly. The first way applies to the special ice detection instruments. The second one is using indirect characteristics of turbine performance. One of such indirect methods for ice detection and power loss estimation has been proposed and used in this paper. The results were compared to the results directly gained from the ice sensors. The data used was measured in Muukko wind farm, southeast Finland during a project 'Wind power in cold climate and complex terrain'. The project was carried out in 9/2013 - 8/2015 with the partners Lappeenranta university of technology, Alstom renovables España S.L., TuuliMuukko, and TuuliSaimaa.
Resumo:
The continual eruptive activity, occurrence of an ancestral catastrophic collapse, and inherent geologic features of Pacaya volcano (Guatemala) demands an evaluation of potential collapse hazards. This thesis merges techniques in the field and laboratory for a better rock mass characterization of volcanic slopes and slope stability evaluation. New field geological, structural, rock mechanical and geotechnical data on Pacaya is reported and is integrated with laboratory tests to better define the physical-mechanical rock mass properties. Additionally, this data is used in numerical models for the quantitative evaluation of lateral instability of large sector collapses and shallow landslides. Regional tectonics and local structures indicate that the local stress regime is transtensional, with an ENE-WSW sigma 3 stress component. Aligned features trending NNW-SSE can be considered as an expression of this weakness zone that favors magma upwelling to the surface. Numerical modeling suggests that a large-scale collapse could be triggered by reasonable ranges of magma pressure (greater than or equal to 7.7 MPa if constant along a central dyke) and seismic acceleration (greater than or equal to 460 cm/s2), and that a layer of pyroclastic deposits beneath the edifice could have been a factor which controlled the ancestral collapse. Finally, the formation of shear cracks within zones of maximum shear strain could provide conduits for lateral flow, which would account for long lava flows erupted at lower elevations.
Resumo:
Analyzing large-scale gene expression data is a labor-intensive and time-consuming process. To make data analysis easier, we developed a set of pipelines for rapid processing and analysis poplar gene expression data for knowledge discovery. Of all pipelines developed, differentially expressed genes (DEGs) pipeline is the one designed to identify biologically important genes that are differentially expressed in one of multiple time points for conditions. Pathway analysis pipeline was designed to identify the differentially expression metabolic pathways. Protein domain enrichment pipeline can identify the enriched protein domains present in the DEGs. Finally, Gene Ontology (GO) enrichment analysis pipeline was developed to identify the enriched GO terms in the DEGs. Our pipeline tools can analyze both microarray gene data and high-throughput gene data. These two types of data are obtained by two different technologies. A microarray technology is to measure gene expression levels via microarray chips, a collection of microscopic DNA spots attached to a solid (glass) surface, whereas high throughput sequencing, also called as the next-generation sequencing, is a new technology to measure gene expression levels by directly sequencing mRNAs, and obtaining each mRNA’s copy numbers in cells or tissues. We also developed a web portal (http://sys.bio.mtu.edu/) to make all pipelines available to public to facilitate users to analyze their gene expression data. In addition to the analyses mentioned above, it can also perform GO hierarchy analysis, i.e. construct GO trees using a list of GO terms as an input.
Resumo:
The kinetics of metal uptake by gel and dry calcium alginate beads was analysed using solutions of copper or lead ions. Gel beads sorbed metal ions faster than the dry ones and larger diffusivities of metal ions were calculated for gel beads: approximately 10−4 cm2/min vs. 10−6 cm2/min for dry beads. In accordance, scanning electron microscopy and nitrogen adsorption data revealed a low porosity of dry alginate particles. However, dry beads showed higher sorption capacities and a mechanical stability more suitable for large-scale use. Two sorption models were fitted to the kinetic results: the Lagergren pseudo-first order and the Ho and McKay pseudo-second order equations. The former was found to be the most adequate to model metal uptake by dry alginate beads and kinetic constants in the orders of 10−3 and 10−2 min−1 were obtained for lead solutions with concentrations up to 100 g/m3. The pseudo-first order model was also found to be valid to describe biosorbent operation with a real wastewater indicating that it can be used to design processes of metal sorption with alginate-based materials.
Resumo:
Recent developments have made researchers to reconsider Lagrangian measurement techniques as an alternative to their Eulerian counterpart when investigating non-stationary flows. This thesis advances the state-of-the-art of Lagrangian measurement techniques by pursuing three different objectives: (i) developing new Lagrangian measurement techniques for difficult-to-measure, in situ flow environments; (ii) developing new post-processing strategies designed for unstructured Lagrangian data, as well as providing guidelines towards their use; and (iii) presenting the advantages that the Lagrangian framework has over their Eulerian counterpart in various non-stationary flow problems. Towards the first objective, a large-scale particle tracking velocimetry apparatus is designed for atmospheric surface layer measurements. Towards the second objective, two techniques, one for identifying Lagrangian Coherent Structures (LCS) and the other for characterizing entrainment directly from unstructured Lagrangian data, are developed. Finally, towards the third objective, the advantages of Lagrangian-based measurements are showcased in two unsteady flow problems: the atmospheric surface layer, and entrainment in a non-stationary turbulent flow. Through developing new experimental and post-processing strategies for Lagrangian data, and through showcasing the advantages of Lagrangian data in various non-stationary flows, the thesis works to help investigators to more easily adopt Lagrangian-based measurement techniques.
Resumo:
This thesis aims to present the ORC technology, its advantages and related problems. In particular, it provides an analysis of ORC waste heat recovery system in different and innovative scenarios, focusing on cases from the biggest to the lowest scale. Both industrial and residential ORC applications are considered. In both applications, the installation of a subcritical and recuperated ORC system is examined. Moreover, heat recovery is considered in absence of an intermediate heat transfer circuit. This solution allow to improve the recovery efficiency, but requiring safety precautions. Possible integrations of ORC systems with renewable sources are also presented and investigated to improve the non-programmable source exploitation. In particular, the offshore oil and gas sector has been selected as a promising industrial large-scale ORC application. From the design of ORC systems coupled with Gas Turbines (GTs) as topper systems, the dynamic behavior of the GT+ORC innovative combined cycles has been analyzed by developing a dynamic model of all the considered components. The dynamic behavior is caused by integration with a wind farm. The electric and thermal aspects have been examined to identify the advantages related to the waste heat recovery system installation. Moreover, an experimental test rig has been realized to test the performance of a micro-scale ORC prototype. The prototype recovers heat from a low temperature water stream, available for instance in industrial or residential waste heat. In the test bench, various sensors have been installed, an acquisitions system developed in Labview environment to completely analyze the ORC behavior. Data collected in real time and corresponding to the system dynamic behavior have been used to evaluate the system performance based on selected indexes. Moreover, various operational steady-state conditions are identified and operation maps are realized for a completely characterization of the system and to detect the optimal operating conditions.
Resumo:
The topic of the Ph.D project focuses on the modelling of the soil-water dynamics inside an instrumented embankment section along Secchia River (Cavezzo (MO)) in the period from 2017 to 2018 and the quantification of the performance of the direct and indirect simulations . The commercial code Hydrus2D by Pc-Progress has been chosen to run the direct simulations. Different soil-hydraulic models have been adopted and compared. The parameters of the different hydraulic models are calibrated using a local optimization method based on the Levenberg - Marquardt algorithm implemented in the Hydrus package. The calibration program is carried out using different types of dataset of observation points, different weighting distributions, different combinations of optimized parameters and different initial sets of parameters. The final goal is an in-depth study of the potentialities and limits of the inverse analysis when applied to a complex geotechnical problem as the case study. The second part of the research focuses on the effects of plant roots and soil-vegetation-atmosphere interaction on the spatial and temporal distribution of pore water pressure in soil. The investigated soil belongs to the West Charlestown Bypass embankment, Newcastle, Australia, that showed in the past years shallow instabilities and the use of long stem planting is intended to stabilize the slope. The chosen plant species is the Malaleuca Styphelioides, native of eastern Australia. The research activity included the design and realization of a specific large scale apparatus for laboratory experiments. Local suction measurements at certain intervals of depth and radial distances from the root bulb are recorded within the vegetated soil mass under controlled boundary conditions. The experiments are then reproduced numerically using the commercial code Hydrus 2D. Laboratory data are used to calibrate the RWU parameters and the parameters of the hydraulic model.
Resumo:
This thesis analyzes the impact of heat extremes in urban and rural environments, considering processes related to severely high temperatures and unusual dryness. The first part deals with the influence of large-scale heatwave events on the local-scale urban heat island (UHI) effect. The temperatures recorded over a 20-year summer period by meteorological stations in 37 European cities are examined to evaluate the variations of UHI during heatwaves with respect to non-heatwave days. A statistical analysis reveals a negligible impact of large-scale extreme temperatures on the local daytime urban climate, while a notable exacerbation of UHI effect at night. A comparison with the UrbClim model outputs confirms the UHI strengthening during heatwave episodes, with an intensity independent of the climate zone. The investigation of the relationship between large-scale temperature anomalies and UHI highlights a smooth and continuous dependence, but with a strong variability. The lack of a threshold behavior in this relationship suggests that large-scale temperature variability can affect the local-scale UHI even in different conditions than during extreme events. The second part examines the transition from meteorological to agricultural drought, being the first stage of the drought propagation process. A multi-year reanalysis dataset involving numerous drought events over the Iberian Peninsula is considered. The behavior of different non-parametric standardized drought indices in drought detection is evaluated. A statistical approach based on run theory is employed, analyzing the main characteristics of drought propagation. The propagation from meteorological to agricultural drought events is found to develop in about 1-2 months. The duration of agricultural drought appears shorter than that of meteorological drought, but the onset is delayed. The propagation probability increases with the severity of the originating meteorological drought. A new combined agricultural drought index is developed to be a useful tool for balancing the characteristics of other adopted indices.
Resumo:
Continuum parallel robots (CPRs) are manipulators employing multiple flexible beams arranged in parallel and connected to a rigid end-effector. CPRs promise higher payload and accuracy than serial CRs while keeping great flexibility. As the risk of injury during accidental contacts between a human and a CPR should be reduced, CPRs may be used in large-scale collaborative tasks or assisted robotic surgery. There exist various CPR designs, but the prototype conception is rarely based on performance considerations, and the CPRs realization in mainly based on intuitions or rigid-link parallel manipulators architectures. This thesis focuses on the performance analysis of CPRs, and the tools needed for such evaluation, such as workspace computation algorithms. In particular, workspace computation strategies for CPRs are essential for the performance assessment, since the CPRs workspace may be used as a performance index or it can serve for optimal-design tools. Two new workspace computation algorithms are proposed in this manuscript, the former focusing on the workspace volume computation and the certification of its numerical results, while the latter aims at computing the workspace boundary only. Due to the elastic nature of CPRs, a key performance indicator for these robots is the stability of their equilibrium configurations. This thesis proposes the experimental validation of the equilibrium stability assessment on a real prototype, demonstrating limitations of some commonly used assumptions. Additionally, a performance index measuring the distance to instability is originally proposed in this manuscript. Differently from the majority of the existing approaches, the clear advantage of the proposed index is a sound physical meaning; accordingly, the index can be used for a more straightforward performance quantification, and to derive robot specifications.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
O objetivo deste estudo foi avaliar as taxas de mortalidade por câncer de boca no período de 1991-2001, no município de Bauru-SP. A fonte de informação utilizada para o reconhecimento e seleção da população-alvo foram Certidões de Óbito dos Cartórios do município de Bauru com dados relativos ao período 1991-2001. Foram coletadas informações referentes a sexo, idade, localização da lesão e endereço. A coleta dos endereços visou à identificação no mapa do município de Bauru da localização geográfica do domicílio. Utilizando ferramentas do geoprocessamento, foi feita a inserção no mapa dos casos identificados. Foram registrados 67 casos de morte por câncer de boca na cidade de Bauru entre 1991 e 2001, com maiores taxas no sexo masculino e sexta década de vida. A análise da distribuição espacial mostra que a maioria dos casos encontra-se próxima à linha férrea que corta o município e foi responsável, em grande parte, pela ocupação territorial pela população, sendo esta também uma área que abrange os bairros mais antigos do município. O câncer de boca constitui importante causa de óbito no município, requerendo um planejamento de ações georreferenciadas pelo sistema local de saúde.
Resumo:
The South Atlantic Magnetic Anomaly (SAMA) is one of the most outstanding anomalies of the geomagnetic field. The SAMA secular variation was obtained and compared to the evolution of other anomalies using spherical harmonic field models for the 1590-2005 period. An analysis of data from four South American observatories shows how this large scale anomaly affected their measurements. Since SAMA is a low total field anomaly, the field was separated into its nondipolar, quadrupolar and octupolar parts. The time evolution of the non-dipole/total, quadrupolar/total and octupolar/total field ratios yielded increasingly high values for the South Atlantic since 1750. The SAMA evolution is compared to the evolution of other large scale surface geomagnetic features like the North and the South Pole and the Siberia High, and this comparison shows the intensity equilibrium between these anomalies in both hemispheres. The analysis of non-dipole fields in historical period suggests that SAMA is governed by (i) quadrupolar field for drift, and (ii) quadrupolar and octupolar fields for intensity and area of influence. Furthermore, our study reinforces the possibility that SAMA may be related to reverse fluxes in the outer core under the South Atlantic region.
Resumo:
Somatic embryogenesis represents a valuable tool for the studies on the basic aspects of plant embryo development. Today this process is used as a potencial technique for large-scale plant micropropagation although, so far, it has been applied to only a small number of species. However, when somatic embryos are malformed they are considered economically useless. In Acca sellowiana (O. Berg) Burret, an important fruit-producing crop, large amounts of anomalous somatic embryos (76.3%) were found just after 40 days of culture of explants in a 2,4-D containing medium. Among the anomalous forms found in the cotiledonary stage, 12.2% consisted of fused embryos, 40.4% displayed fused cotyledons, 13.0% presented supernumerary cotyledons, and 10.7% showed absence or poorly developed cotyledons, including those without the shoot apical meristem. Histological analyses indicated that the altered embryos were formed either directly from cotyledons, hypocotyl and radicle of the zygotic embryos used as explants, or indirectly from calli formed from these tissue parts. It is suggested that the formation of anomalous somatic embryos, as well as a low frequency of conversion into emblings reflect physiological and/or genetic disturbances triggered by the presence of 2,4-D in the medium. In vitro experimental alternative approaches are discussed in order to lessen the occurrence of malformed somatic embryos.
Resumo:
Background: High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results: We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions: This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity >= 2%. The development of a much larger array of informative SNPs across multiple Eucalyptus species is feasible, although strongly dependent on having a representative and sufficiently deep collection of sequences from many individuals of each target species. A higher density SNP platform will be instrumental to undertake genome-wide phylogenetic and population genomics studies and to implement molecular breeding by Genomic Selection in Eucalyptus.