Alteração da atividade enzimática em organismos aquáticos por poluentes de origem agrícola: uma abordagem geral e sobre a suscetibilidade da fosfatase ácida

The input of agrochemicals in the aquatic compartment can results in biochemical injuries for living organisms. In this context, the knowledge of alterations of enzymatic activities due the presence of agriculture pollutants contributes for the elucidation of the mechanisms of toxicity, implementation of economic methods for monitoring purposes and establishment of maximum allowed concentrations. In the present work, the above considerations are discussed, and data concerning changes in enzymatic function by pesticides and fertilizer contaminants are reviewed. Also, we focused on the acid phosphatase due its susceptibility to several pollutants and diversity in cellular functions.

Sulfetos volatilizáveis por acidificação e metais extraídos simultaneamente na avaliação de sedimentos de água doce

This paper discusses the historical and methodological fundaments of the dynamics and quantification of acid volatile sulfides (AVS) and simultaneously extracted metals (SEM) in aquatic sediments. It also discusses the SEM/AVS relationship, which involves several controversial aspects such as sulfide stability, sulfide-organic matter interaction, and the inability to predict the toxicity of organic compounds in the environment. This relationship is an important tool for the inference of metal bioavailability. The use of ecotoxicological tests with target organisms regulated by international standards is also a relevant aspect.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Indicadores dermatoglificos de aptidão fisica e efeito dos treinamentos intervalado versus continuo na pratica da corrida em piscina funda : intervenção com mulheres obesas

Universidade Estadual de Campinas . Faculdade de Educação Física

Deep Water Running para redução da gordura corporal em mulheres na meia idade : estudo de intervenção em Campinas - SP

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividades aquaticas para crianças portadoras de deficiencias : uma proposta de adaptação ao meio-liquido

Universidade Estadual de Campinas . Faculdade de Educação Física

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

Population dynamics: seasonal variation of phytoplankton functional groups in brazilian reservoirs (Billings and Guarapiranga, São Paulo)

Phytoplankton may function as a "sensor" of changes in aquatic environment and responds rapidly to such changes. In freshwaters, coexistence of species that have similar ecological requirements and show the same environmental requirements frequently occurs; such species groups are named functional groups. The use of phytoplankton functional groups to evaluate these changes has proven to be very useful and effective. Thus, the aim of this study was to evaluate the occurrence of functional groups of phytoplankton in two reservoirs (Billings and Guarapiranga) that supply water to millions of people in São Paulo city Metropolitan Area, southeastern Brazil. Surface water samples were collected monthly and physical, chemical and biological (quantitative and qualitative analyses of the phytoplankton) were performed. The highest biovolume (mm³.L-1) of the descriptor species and functional groups were represented respectively by Anabaena circinalis Rabenh. (H1), Microcystis aeruginosa (Kützing) Kützing (L M/M) and Mougeotia sp. (T) in the Guarapiranga reservoir and Cylindrospermopsis raciborskii (Wolosz.) Seen. and Subba Raju (S N), Microcystis aeruginosa and M. panniformis Komárek et al. (L M/M), Planktothrix agardhii (Gom.) Anagn. and Komárek and P. cf. clathrata (Skuja) Anagn. and Komárek (S1) in the Billings reservoir. The environmental factors that most influenced the phytoplankton dynamics were water temperature, euphotic zone, turbidity, conductivity, pH, dissolved oxygen, nitrate and total phosphorous.

A multi-screening approach for marine-derived fungal metabolites and the isolation of cyclodepsipeptides from Beauveria felina

Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.

Experimental infections with Paracoccidioides brasiliensis obtained from armadillos: comparison to clinical isolates

Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.

Influência das características das substâncias húmicas aquáticas na eficiência da coagulação com o cloreto férrico

The aim of this study was to verify the influence of the apparent molecular size of aquatic humic substances on the effectiveness of coagulation with ferric chloride. Coagulation-filtration tests using jar test and bench-scale sand filters were carried out on samples of water with true color of approximately 100 Hazen units, prepared with aquatic humic substances of different molecular sizes (F1: < 0.45 µm, F2: 100 kDa - 0.45 µm, F3: 30 - 100 kDa and F4': < 30 kDa). For the water samples with lower apparent molecular size fractions, greater dosages of coagulant was needed to remove the color around 5.0 Hanzen units, mainly because these water samples contain higher concentrations of fulvic acids, which exhibited a larger number of negatively-charged groups.

Estudo da mobilização de metais e elementos traços em ambientes aquáticos do semi-árido brasileiro aplicando análises de componentes principais

The spatial and temporal retention of metals has been studied in water and sediments of the Gavião River, Anagé and Tremedal Reservoirs, located in the semi-arid region, Bahia - Brazil, in order to identify trends in the fluxes of metals from the sediments to the water column. The determination of metals was made by ICP OES and ET AAS. The application of statistical methods showed that this aquatic system presents suitable conditions to move Cd2+ and Pb2+ from the water column to the sediment.

Larva of Atractocerus Brasiliensis (Lepeletier & Audinet-Serville, 1825) (Lymexylidae, Atractocerinae)

The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.

Morfologia dos órgãos genitais masculinos do Jurará Kinosternon scorpioides (Chelonia: Kinosternidae)

Kinosternon scorpioides é uma pequena tartaruga semi-aquática, típica de água doce, de distribuição geográfica bastante diversificada, encontrada no estado do Maranhão, onde é denominada de jurará ou muçuã. Sua carne é uma excelente fonte de proteína e a despeito da legislação vigente, é comercializado nas praias e feiras da cidade de São Luís e consumido nos restaurantes sob a forma de farofa servida em casquinha. Os órgãos genitais do macho foram estudados visando fornecer dados morfológicos da própria espécie, que poderão ser utilizados na biologia reprodutiva voltada para ações de preservação em cativeiro. Compõe-se a amostra de 10 machos adultos, obtidos mediante apreensões do IBAMA-MA (Proc. nº 020.12.002400/99-31, licença nº 002/01), os quais foram eutanaziados conforme normas do Comitê de Ética do Curso de Medicina Veterinária, Universidade Estadual do Maranhão. A cavidade celomática foi aberta e os órgãos fixados em solução aquosa de formaldeído 10%, e posteriormente dissecados. Os testículos possuem formato ovóide e coloração amarelo-ouro. Os epidídimos convolutos estavam aderidos dorsalmente à superfície medial dos testículos, terminando em um pequeno ducto deferente. Os ductos deferentes não forma-ram nenhuma ampola distinta, abrindo-se na cloaca. O pênis sulcado, localizado no assoalho da cloaca, estendeu-se até a cauda, composto de raíz, corpo e glande. A morfologia dos órgãos reprodutivos destes animais assemelha-se aos de outras tartarugas, sugerindo uma morfologia conservada entre as tartarugas.

Aeromonas detection and their toxins from drinking water form reservoirs and drinking fountains

Aeromonads are inhabitants of aquatic ecosystems and are described as being involved in intestinal disturbances and other infections. A total of 200 drinking water samples from domestic and public reservoirs and drinking fountains located in São Paulo (Brazil), were analyzed for the presence of Aeromonas. Samples were concentrated by membrane filtration and enriched in APW. ADA medium was used for Aeromonas isolation and colonies were confirmed by biochemical characterization. Strains isolated were tested for hemolysin and toxin production. Aeromonas was detected in 12 samples (6.0%). Aeromonas strains (96) were isolated and identified as: A. caviae (41.7%), A. hydrophila (15.7%), A.allosacharophila (10.4%), A. schubertii (1.0%) and Aeromonas spp. (31.2%).The results revealed that 70% of A. caviae, 66.7% of A. hydrophila, 80% of A. allosacharophila and 46.6% of Aeromonas spp. were hemolytic. The assay for checking production of toxins showed that 17.5% of A. caviae, 73.3% of A. hydrophila, 60% of A. allosacharophila, 100% of A. schubertii, and 33.3% of Aeromonas spp. were able to produce toxins. The results demonstrated the pathogenic potential of Aeromonas, indicating that the presence of this emerging pathogen in water systems is a public health concern