829 resultados para recurrent events
Resumo:
Gamma frequency (about 20–70 Hz) oscillations occur during novel sensory stimulation, with tight synchrony over distances of at least 7 mm. Synchronization in the visual system has been proposed to reflect coactivation of different parts of the visual field by a single spatially extended object. We have shown that intracortical mechanisms, including spike doublet firing by interneurons, can account for tight long-range synchrony. Here we show that synchronous gamma oscillations in two sites also can cause long-lasting (>1 hr) potentiation of recurrent excitatory synapses. Synchronous oscillations lasting >400 ms in hippocampal area CA1 are associated with an increase in both excitatory postsynaptic potential (EPSP) amplitude and action potential afterhyperpolarization size. The resulting EPSPs stabilize and synchronize a prolonged beta frequency (about 10–25 Hz) oscillation. The changes in EPSP size are not expressed during non-oscillatory behavior but reappear during subsequent gamma-oscillatory events. We propose that oscillation-induced EPSPs serve as a substrate for memory, whose expression either enhances or blocks synchronization of spatially separated sites. This phenomenon thus provides a dynamical mechanism for storage and retrieval of stimulus-specific neuronal assemblies.
Resumo:
Homing endonuclease genes show super-Mendelian inheritance, which allows them to spread in populations even when they are of no benefit to the host organism. To test the idea that regular horizontal transmission is necessary for the long-term persistence of these genes, we surveyed 20 species of yeasts for the ω-homing endonuclease gene and associated group I intron. The status of ω could be categorized into three states (functional, nonfunctional, or absent), and status was not clustered on the host phylogeny. Moreover, the phylogeny of ω differed significantly from that of the host, strong evidence of horizontal transmission. Further analyses indicate that horizontal transmission is more common than transposition, and that it occurs preferentially between closely related species. Parsimony analysis and coalescent theory suggest that there have been 15 horizontal transmission events in the ancestry of our yeast species, through simulations indicate that this value is probably an underestimate. Overall, the data support a cyclical model of invasion, degeneration, and loss, followed by reinvasion, and each of these transitions is estimated to occur about once every 2 million years. The data are thus consistent with the idea that frequent horizontal transmission is necessary for the long-term persistence of homing endonuclease genes, and further, that this requirement limits these genes to organisms with easily accessible germ lines. The data also show that mitochondrial DNA sequences are transferred intact between yeast species; if other genes do not show such high levels of horizontal transmission, it would be due to lack of selection, rather than lack of opportunity.
Resumo:
Aims Fibrates or nicotinic acid are usually recommended for secondary prevention of coronary heart disease in patients with low plasma levels of both low-density tipoprotein cholesterol (LDL-C) less than or equal to140 mg/dL (less than or equal to3.6 mmol/L) and high-density lipoprotein cholesterol (HDL-C) less than or equal to40 mg/dL (less than or equal to1.03 mmol/L). The LIPID trial, a randomised, placebo-controlled trial in 9014 patients at 87 centres in Australia and New Zealand, provided an opportunity to investigate the effects of an HMG-CoA reductase inhibitor in patients with tow LDL-C and tow HDL-C. Methods and results Participants in this post hoc substudy were 2073 patients aged 31-75 years with baseline LDL-C less than or equal to140 mg/dL (less than or equal to3.6 mmoL/L), HDL-C less than or equal to40 mg/dL (less than or equal to1.03 mmol/L), and triglyceride less than or equal to300 mg/dL (less than or equal to3.4 mmol/L). The relative risk reduction with pravastatin treatment was 27% for major coronary events (95% Cl 8-42%), 27% for coronary heart disease mortality (95% CI 0-47%), 21% for all-cause mortality (95% Cl 0-38%), and 51% for stroke (95% CI 24-69%). The number needed to treat to prevent a major coronary event over 6 years was 22. Conclusions Treatment with pravastatin in patients with both low LDL-C and low HDL-C significantly reduced major coronary events, stroke, and all-cause mortality. The level of HDL-C is crucial to the risk of recurrent CHD events and, consequently, the benefit of lowering LDL-C. (C) 2004 Published by Elsevier Ltd on behalf of The European Society of Cardiology.
Resumo:
PURPOSE. To report differences in the incidence of adverse events and discontinuations found in a group of neophyte contact wearers using two different silicone hydrogel contact lenses on a daily- and continuous-wear basis during an 18-month period. METHODS. Sixty-one subjects were initially examined, and 53 were eligible to participate in the study. Eligible subjects were randomly assigned to wear one of two silicone hydrogel materials: lotrafilcon A or balafilcon A lenses on a daily- or continuous-wear basis. After an initial screening, subjects were monitored weekly for the first month and then after 3, 6, 12, and 18 months. The incidence of adverse events, including corneal infiltrative events, superior epithelial arcuate lesions, and contact lens-induced papillary conjunctivitis, and discontinuations in each of the four contact lens groups were recorded. RESULTS. Twenty-two adverse events were found. A higher incidence of adverse events was found in subjects wearing lotrafilcon A lenses than in those wearing balafilcon A lenses (χ = 4.40, P=0.04). There were fewer adverse events in subjects wearing lenses on a daily-wear basis than in those wearing lenses on a continuous-wear basis (χ = 5.98, P=0.01). Eight subjects discontinued from the study as a result of recurrent corneal infiltrative events (one), vision problems (two), excessive ocular discomfort (one), relocation (one), noncompliance with the study protocol (one), and being lost to follow-up (two). No significant differences were found in the number of discontinuations between the two lens types (χ = 0.66, P=0.42) and wearing regimens (χ = 0.08, P=0.78). CONCLUSIONS. Lotrafilcon A lenses were associated with a higher incidence of adverse events than balafilcon A lenses were, and this difference is attributed to the difference in the incidence of corneal infiltrative events. Subjects wearing lenses on a daily-wear basis had fewer adverse events than did subjects wearing lenses on a continuous-wear basis. Both lens types and wearing regimens showed a similar incidence of discontinuations. © 2007 Lippincott Williams & Wilkins, Inc.
Resumo:
Hairy cell leukemia (HCL) is marked by near 100% mutational frequency of BRAFV600E mutations. Recurrent cooperating genetic events that may contribute to HCL pathogenesis or affect the clinical course of HCL are currently not described. Therefore, we performed whole exome sequencing to explore the mutational landscape of purine analog refractory HCL. In addition to the disease-defining BRAFV600E mutations, we identified mutations in EZH2, ARID1A, and recurrent inactivating mutations of the cell cycle inhibitor CDKN1B (p27). Targeted deep sequencing of CDKN1B in a larger cohort of HCL patients identify deleterious CDKN1B mutations in 16% of patients with HCL (n = 13 of 81). In 11 of 13 patients the CDKN1B mutation was clonal, implying an early role of CDKN1B mutations in the pathogenesis of HCL. CDKN1B mutations were not found to impact clinical characteristics or outcome in this cohort. These data identify HCL as having the highest frequency of CDKN1B mutations among cancers and identify CDNK1B as the second most common mutated gene in HCL. Moreover, given the known function of CDNK1B, these data suggest a novel role for alterations in regulation of cell cycle and senescence in HCL with CDKN1B mutations.
Resumo:
Background Recurrent stroke is a frequent, disabling event after ischemic stroke. This study compared the efficacy and safety of two antiplatelet regimens — aspirin plus extendedrelease dipyridamole (ASA–ERDP) versus clopidogrel. Methods In this double-blind, 2-by-2 factorial trial, we randomly assigned patients to receive 25 mg of aspirin plus 200 mg of extended-release dipyridamole twice daily or to receive 75 mg of clopidogrel daily. The primary outcome was first recurrence of stroke. The secondary outcome was a composite of stroke, myocardial infarction, or death from vascular causes. Sequential statistical testing of noninferiority (margin of 1.075), followed by superiority testing, was planned. Results A total of 20,332 patients were followed for a mean of 2.5 years. Recurrent stroke occurred in 916 patients (9.0%) receiving ASA–ERDP and in 898 patients (8.8%) receiving clopidogrel (hazard ratio, 1.01; 95% confidence interval [CI], 0.92 to 1.11). The secondary outcome occurred in 1333 patients (13.1%) in each group (hazard ratio for ASA–ERDP, 0.99; 95% CI, 0.92 to 1.07). There were more major hemorrhagic events among ASA–ERDP recipients (419 [4.1%]) than among clopidogrel recipients (365 [3.6%]) (hazard ratio, 1.15; 95% CI, 1.00 to 1.32), including intracranial hemorrhage (hazard ratio, 1.42; 95% CI, 1.11 to 1.83). The net risk of recurrent stroke or major hemorrhagic event was similar in the two groups (1194 ASA–ERDP recipients [11.7%], vs. 1156 clopidogrel recipients [11.4%]; hazard ratio, 1.03; 95% CI, 0.95 to 1.11). Conclusions The trial did not meet the predefined criteria for noninferiority but showed similar rates of recurrent stroke with ASA–ERDP and with clopidogrel. There is no evidence that either of the two treatments was superior to the other in the prevention of recurrent stroke. (ClinicalTrials.gov number, NCT00153062.)
Resumo:
Hereditary angioedema (HAE) with C1 inhibitor deficiency manifests as recurrent episodes of edema involving the skin, upper respiratory tract and gastrointestinal tract. It can be lethal due to asphyxia. The aim here was to evaluate the response to therapy for these attacks using icatibant, an inhibitor of the bradykinin receptor, which was recently introduced into Brazil. Prospective experimental single-cohort study on the efficacy and safety of icatibant for HAE patients. Patients with a confirmed HAE diagnosis were enrolled according to symptoms and regardless of the time since onset of the attack. Icatibant was administered in accordance with the protocol that has been approved in Brazil. Symptom severity was assessed continuously and adverse events were monitored. 24 attacks in 20 HAE patients were treated (female/male 19:1; 19-55 years; median 29 years of age). The symptoms were: subcutaneous edema (22/24); abdominal pain (15/24) and upper airway obstruction (10/24). The time taken until onset of relief was: 5-10 minutes (5/24; 20.8%); 10-20 (5/24; 20.8%); 20-30 (8/24; 33.4%); 30-60 (5/24; 20.8%); and 2 hours (1/24; 4.3%). The time taken for complete resolution of symptoms ranged from 4.3 to 33.4 hours. Adverse effects were only reported at injection sites. Mild to moderate erythema and/or feelings of burning were reported by 15/24 patients, itching by 3 and no adverse effects in 6. HAE type I patients who received icatibant responded promptly; most achieved improved symptom severity within 30 minutes. Local adverse events occurred in 75% of the patients.
Resumo:
This study tested whether myocardial extracellular volume (ECV) is increased in patients with hypertension and atrial fibrillation (AF) undergoing pulmonary vein isolation and whether there is an association between ECV and post-procedural recurrence of AF. Hypertension is associated with myocardial fibrosis, an increase in ECV, and AF. Data linking these findings are limited. T1 measurements pre-contrast and post-contrast in a cardiac magnetic resonance (CMR) study provide a method for quantification of ECV. Consecutive patients with hypertension and recurrent AF referred for pulmonary vein isolation underwent a contrast CMR study with measurement of ECV and were followed up prospectively for a median of 18 months. The endpoint of interest was late recurrence of AF. Patients had elevated left ventricular (LV) volumes, LV mass, left atrial volumes, and increased ECV (patients with AF, 0.34 ± 0.03; healthy control patients, 0.29 ± 0.03; p < 0.001). There were positive associations between ECV and left atrial volume (r = 0.46, p < 0.01) and LV mass and a negative association between ECV and diastolic function (early mitral annular relaxation [E'], r = -0.55, p < 0.001). In the best overall multivariable model, ECV was the strongest predictor of the primary outcome of recurrent AF (hazard ratio: 1.29; 95% confidence interval: 1.15 to 1.44; p < 0.0001) and the secondary composite outcome of recurrent AF, heart failure admission, and death (hazard ratio: 1.35; 95% confidence interval: 1.21 to 1.51; p < 0.0001). Each 10% increase in ECV was associated with a 29% increased risk of recurrent AF. In patients with AF and hypertension, expansion of ECV is associated with diastolic function and left atrial remodeling and is a strong independent predictor of recurrent AF post-pulmonary vein isolation.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
INTRODUCTION AND OBJECTIVES: Recurrent aphthous stomatitis (RAS) is the most common type of ulcerative disease of the oral mucosa. Despite its worldwide occurrence and the extensive amount of research that has been devoted to the subject, the etiology of RAS remains unclear. Nevertheless, several hereditary, nutritional, infectious and psychological factors have been associated with RAS. The aim of this case-control study was to assess the influence of psychological stress on the manifestation of RAS. METHOD: Fifty patients were enrolled in the trial. Twenty-five RAS patients constituted the study group and another 25 non-RAS patients who were similarly matched for sex, age and socioeconomic status constituted the control group. Each patient was evaluated in terms of the four domains of stress (emotional, physical, social and cognitive) using an internationally validated questionnaire, which was comprised of 59 items and measured the frequency and intensity of stress symptoms. The RAS group was interviewed during an active RAS episode. Completed questionnaires were submitted to proper analytical software and interpreted by an expert psychologist. RESULTS: There was a higher level of psychological stress among RAS group patients when compared to the control group (P < 0.05). CONCLUSION: Psychological stress may play a role in the manifestation of RAS; it may serve as a trigger or a modifying factor rather than being a cause of the disease.
Resumo:
PURPOSE: This study aimed to evaluate the efficacy of the systemic drugs thalidomide, dapsone, colchicine, and pentoxifylline in the treatment of severe manifestations of RAS. METHODS: An open, 4-year clinical trial was carried out for 21 consecutive patients with severe RAS. Initially, patients were given a 2-week course of prednisone to bring them to a baseline status. Simultaneously, one of the four test drugs was assigned to each patient to be taken for a period of 6 months. During the course of the trial, patients were switched to one of the other three drugs whenever side effects or a lack of satisfactory results occurred, and the 6-month limit of the treatment was then reset. RESULTS: The most efficient and best-tolerated drug was thalidomide, which was administered to a total of eight patients and resulted in complete remission in seven (87.5%). Dapsone was prescribed for a total of nine patients, of whom eight (89%) showed improvement in their symptoms, while five showed complete remission. Colchicine was administered to a total of ten patients, with benefits observed in nine (90%), of whom four showed complete remission. Pentoxyfilline was administered to a total of five patients, with benefits observed in three (60%), of whom one patient showed complete remission. CONCLUSION: The therapeutic methods used in this trial provided significant symptom relief. Patients experienced relapses of the lesions; however, this occurred after withdrawal of their medication during the follow-up period.