Metaphor in (Arabic-into-English) translation with specific reference to metaphorical concepts and expressions in political discourse

Cognitive linguistics scholars argue that metaphor is fundamentally a conceptual process of mapping one domain of experience onto another domain. The study of metaphor in the context of Translation Studies has not, unfortunately, kept pace with the discoveries about the nature and role of metaphor in the cognitive sciences. This study aims primarily to fill part of this gap of knowledge. Specifically, the thesis is an attempt to explore some implications of the conceptual theory of metaphor for translation. Because the study of metaphor in translation is also based on views about the nature of translation, the thesis first presents a general overview of the discipline of Translation Studies, describing the major models of translation. The study (in Chapter Two) then discusses the major traditional theories of metaphor (comparison, substitution and interaction theories) and shows how the ideas of those theories were adopted in specific translation studies of metaphor. After that, the study presents a detailed account of the conceptual theory of metaphor and some hypothetical implications for the study of metaphor in translation from the perspective of cognitive linguistics. The data and methodology are presented in Chapter Four. A novel classification of conceptual metaphor is presented which distinguishes between different source domains of conceptual metaphors: physical, human-life and intertextual. It is suggested that each source domain places different demands on translators. The major sources of the data for this study are (1) the translations done by the Foreign Broadcasting Information Service (FBIS), which is a translation service of the Central Intelligence Agency (CIA) in the United Sates of America, of a number of speeches by the Iraqi president Saddam Hussein during the Gulf Crisis (1990-1991) and (2) official (governmental) Omani translations of National Day speeches of Sultan Qaboos bin Said of Oman.

Cognitive neuroscience: the evolution of a discipline

Preface. The evolution of cognitive neuroscience has been spurred by the development of increasingly sophisticated investigative techniques to study human cognition. In Methods in Mind, experts examine the wide variety of tools available to cognitive neuroscientists, paying particular attention to the ways in which different methods can be integrated to strengthen empirical findings and how innovative uses for established techniques can be developed. The book will be a uniquely valuable resource for the researcher seeking to expand his or her repertoire of investigative techniques. Each chapter explores a different approach. These include transcranial magnetic stimulation, cognitive neuropsychiatry, lesion studies in nonhuman primates, computational modeling, psychophysiology, single neurons and primate behavior, grid computing, eye movements, fMRI, electroencephalography, imaging genetics, magnetoencephalography, neuropharmacology, and neuroendocrinology. As mandated, authors focus on convergence and innovation in their fields; chapters highlight such cross-method innovations as the use of the fMRI signal to constrain magnetoencephalography, the use of electroencephalography (EEG) to guide rapid transcranial magnetic stimulation at a specific frequency, and the successful integration of neuroimaging and genetic analysis. Computational approaches depend on increased computing power, and one chapter describes the use of distributed or grid computing to analyze massive datasets in cyberspace. Each chapter author is a leading authority in the technique discussed.

The relationship between classroom interactions and exclusionary discipline as a social practice: A critical microethnograhy

Exclusionary school discipline results in students being removed from classrooms as a consequence of their disruptive behavior and may lead to subsequent suspension and/or expulsion. Literature documents that nondominant students, particularly Black males, are disproportionately impacted by exclusionary discipline, to the point that researchers from a variety of critical perspectives consider exclusionary school discipline an oppressive educational practice and condition. Little or no research examines specific teacher-student social interactions within classrooms that influence teachers’ decisions to use or not use exclusionary discipline. Therefore, this study set forth the central research question: In relation to classroom interactions in alternative education settings, what accounts for teachers’ use or non-use of exclusionary discipline with students? A critical social practice theory of learning served as the framework for exploring this question, and a critical microethnographic methodology informed the data collection and analysis. ^ Criterion sampling was used to select four classrooms in the same alternative education school with two teachers who frequently and two who rarely used exclusionary discipline. Nine stages of data collection and reconstructive data analysis were conducted. Data collection involved video recorded classroom observations, digitally recorded interviews of teachers and students discussing selected video segments, and individual teacher interviews. Reconstructive data analysis procedures involved hermeneutic inferencing of possible underlying meanings, critical discourse analysis, interactive power analysis and role analysis, thematic analysis of the interactions in each classroom, and a final comparative analysis of the four classrooms. ^ Four predominant themes of social interaction (resistance, conformism, accommodation, and negotiation) emerged with terminology adapted from Giroux’s (2001) theory of resistance in education and Third Space theory (Gutiérrez, 2008). Four types of power (normative, coercive, interactively established contracts, and charm), based on Carspecken’s (1996) typology, were found in the interactions between teacher and students in varying degrees for different purposes. ^ This research contributes to the knowledge base on teacher-student classroom interactions, specifically in relation to exclusionary discipline. Understanding how the themes and varying power relations influence their decisions and actions may enable teachers to reduce use of exclusionary discipline and remain focused on positive teacher-student academic interactions. ^

A study of the relationship between educational placement and the achievement of urban low socioeconomic Hispanic middle school students with and without specific learning disabilities

Public schools traditionally have been held accountable for educating the majority of the nation’s school children, and through the years, these schools have been evaluated in a variety of ways. Currently, evaluation measures for accountability purposes consist solely of standardized test scores. In the past, only test scores of general education students were analyzed. Laws governing the education of students with disabilities, however, have extended accountability measures not only to include those students, but to report their scores in a disaggregated form (No Child Left Behind Act, 2001). The recent emphasis on accountability and compliance has resulted in the need for schools to carefully examine how programs, services, and policies impact student achievement (Bowers & Figgers, 2003). ^ Standard-based school reform and accountability systems have raised expectations about student learning outcomes for all students, including those with disabilities and minority students. Yet, overall, racial/ethnic minority students are performing well below their White non-Hispanic peers in most academic areas. Additionally, with respect to special education, there exists an enduring problem of disproportionate representation of racial/ethnic minority students (National Research Council, 2000). ^ This study examined classroom placement (inclusive versus non-inclusive) relative to academic performance of urban, low socioeconomic Hispanic students with and without disabilities in secondary content area classrooms. A mixed method research design was used to investigate this important issue using data from a local school district and results from field observations. The study compared performance levels of four middle school Hispanic student subgroups (students with disabilities in inclusive settings, students without disabilities in inclusive settings, students with disabilities in resource settings, and student without disabilities in general education settings) each in their respective placements for two consecutive years, exploring existing practices within authentic settings. ^ Significant differences were found in the relationship of educational placement and achievement between grade level and disability in the areas of math and reading. Additionally, clear and important differences were observed in student-teacher interactions. Recommendations for further researchers and stakeholders include soliciting responses from teams at the schools composed of general education and special education teachers, administrative personnel, and students as well as broadening the study across grade levels and exceptionalities. ^

The Relationship between Classroom Interactions and Exclusionary Discipline as a Social Practice: A Critical Microethnography

Exclusionary school discipline results in students being removed from classrooms as a consequence of their disruptive behavior and may lead to subsequent suspension and/or expulsion. Literature documents that nondominant students, particularly Black males, are disproportionately impacted by exclusionary discipline, to the point that researchers from a variety of critical perspectives consider exclusionary school discipline an oppressive educational practice and condition. Little or no research examines specific teacher-student social interactions within classrooms that influence teachers’ decisions to use or not use exclusionary discipline. Therefore, this study set forth the central research question: In relation to classroom interactions in alternative education settings, what accounts for teachers’ use or non-use of exclusionary discipline with students? A critical social practice theory of learning served as the framework for exploring this question, and a critical microethnographic methodology informed the data collection and analysis. Criterion sampling was used to select four classrooms in the same alternative education school with two teachers who frequently and two who rarely used exclusionary discipline. Nine stages of data collection and reconstructive data analysis were conducted. Data collection involved video recorded classroom observations, digitally recorded interviews of teachers and students discussing selected video segments, and individual teacher interviews. Reconstructive data analysis procedures involved hermeneutic inferencing of possible underlying meanings, critical discourse analysis, interactive power analysis and role analysis, thematic analysis of the interactions in each classroom, and a final comparative analysis of the four classrooms. Four predominant themes of social interaction (resistance, conformism, accommodation, and negotiation) emerged with terminology adapted from Giroux’s (2001) theory of resistance in education and Third Space theory (Gutiérrez, 2008). Four types of power (normative, coercive, interactively established contracts, and charm), based on Carspecken’s (1996) typology, were found in the interactions between teacher and students in varying degrees for different purposes. This research contributes to the knowledge base on teacher-student classroom interactions, specifically in relation to exclusionary discipline. Understanding how the themes and varying power relations influence their decisions and actions may enable teachers to reduce use of exclusionary discipline and remain focused on positive teacher-student academic interactions.

On gathering in Art therapy: a way to understand and build the discipline with the other

In the present article I try to share some reflections on a case study of an attachment disorder child I worked with for two years through art therapy in a day hospital. Those reflections let me go deeply in some specific elements concerning the discipline which let us delimit its theoretical and methodological possible scope. In this way, from the specific of the case study on propose to reflect on those elements that conform a methodology related to the art therapist way of doing, in order to concrete and evaluate other possible interventions to develop in similar cases and contexts.

Searching for Predictive Subgroups

Thesis (Ph.D.)--University of Washington, 2016-08

Cariology In Curriculum Of Brazilian Dental Schools.

Reasons for the iniquities of caries, globally recognized, may be related to how Cariology has been taught in dental schools. In Brazil, the most important universities, when considering healthcare teaching, are the public ones. The objective of this study was to identify the insertion of the contents of Cariology in the course flowcharts of public dental schools in the country. The survey was conducted in 2013 seeking to identify the realities of different geographical regions, aimed to the census of public dental schools. It was performed a documentary analysis of the menus of disciplines, identifying the following issues: number of dental schools that include content related to Cariology in their curricula; average total workload undergraduate courses and disciplines that contemplate the theme; distribution of disciplines in professional training cycles (basic, clinical and public health); existence of discipline and/or a specific department; verification of bibliographic indication directly related to Cariology. The response rate was 93.6%. All dental schools recommended specific books, and none of them had a Department of Cariology. All dental schools in the country contemplated content related to Cariology in their disciplines, distributed in specific disciplines (except for the Northern region) and disciplines in the three cycles of learning (basic, clinical and public health), with larger workload in the clinical cycle. Although public dental schools in Brazil demonstrated commitment to contemplating the content related to Cariology in their disciplines, the emphasis on the clinical cycle may not be promoting the integrated formation of students, which could be contributing to reflect the inequalities of the disease in the country.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Dentin Bond Strength Of A Fluoride-releasing Adhesive System Submitted To Ph-cycling.

To evaluate the microtensile bond strength (µTBS) of a fluoride-containing adhesive system submitted to a pH-cycling and storage time regimen for primary outcomes. As secondary outcomes the fluoride released amount was evaluated. Twelve dentin surfaces from sound third molar were divided into 2 groups according to adhesive systems: Clearfil SE Protect (PB) and Clearfil SE Bond (SE). Sticks obtained (1.0 mm2) from teeth were randomly divided into 3 subgroups according to storage regimen model: immediate (24h); 5-month deionized water (W); and pH-cycling model (C). All sticks were tested for µTBS in a universal testing machine. Fluoride concentration was obtained from 1-4 days and 30-day in W and 1-4 days in demineralization (DE)/remineralization (RE) solutions from C, using a fluoride-specific electrode. µTBS and fluoride released data were, respectively, submitted to ANOVA in a split plot design and Tukey, and Friedman' tests (a=0.05). There was no significant interaction between adhesive system and storage regimen for µTBS. W showed the lowest µTBS values. There was no significant difference between 24 h and C models for µTBS. There was no significant difference between adhesive systems. Failure mode was predominantly cohesive within composite for the 24 h and W, for the C group it was mixed for SE and cohesive within composite for PB adhesive system. Fluoride concentrations in the DE/RE solutions were less than 0.03125 ppm and not detected in W. In conclusion, the fluoride-containing adhesive system performed similarly to the regular one. Hydrolytic degradation is the main problem with both adhesive systems, regardless of fluoride contents.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

A lingüística indígena no Brasil

This article presents a panorama of the area of the linguistics of the indigenous languages in Brazil within the discipline of Brazilian linguiistics as a whole. Special attention is given to those aspects related to its specific development. It is argued that in contrast to what is commonly supposed, the arrival of the Summer Institute of Linguistics (1959) not only was not the beginning of this area of study in the country, but it even contributed to the delay in its establishment. It was only after the return of Brazilian scholars educated abroad who were interested in the study of the national indigenous languages that a specialized branch of linguistics directed to the study of these languages began to take form. The present situation of the area and perspectives for future development are both explored.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Significados do taiko no Instituto Cultural Nipo Brasileiro de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física