Fatal combined infection with canine distemper virus and orthopoxvirus in a group of Asian marmots (Marmota caudata)

A fatal combined infection with canine distemper virus (CDV) and orthopoxvirus (OPXV) in Asian marmots (Marmota caudata) is reported in this article. A total of 7 Asian marmots from a small zoological garden in Switzerland were found dead in hibernation during a routine check in the winter of 2011. The marmots died in February 2011. No clinical signs of disease were observed at any time. The viruses were detected in all individuals for which the tissues were available (n = 3). Detection of the viruses was performed by reverse transcription polymerase chain reaction. The most consistent gross lesion was a neck and thorax edema. A necrotizing pharyngitis and a multifocal necrotizing pneumonia were observed histologically. Numerous large intracytoplasmic eosinophilic inclusions were seen in the epithelial cells of the pharynx, of the airways, and in the skin keratinocytes. Brain lesions were limited to mild multifocal gliosis. Phylogenetic analysis revealed that the marmot CDV strain was closely related to the clusters of CDVs detected in Switzerland in wild carnivores during a local outbreak in 2002 and the 2009-2010 nationwide epidemic, suggesting a spillover of this virus from wildlife. The OPXV was most closely related to a strain of cowpoxvirus, a poxvirus species considered endemic in Europe. This is the first reported instance of CDV infection in a rodent species and of a combined CDV and OPXV infection.

Production of antibodies to canine IL-1beta and canine TNF to assess the role of proinflammatory cytokines

IL-1 and TNF are important proinflammatory cytokines implicated in both antimicrobial host defense and pathogenesis of diseases with an immune-mediated and/or inflammatory component. Respective studies in the dog have been hampered by the unavailability of reagents allowing the specific measurement of canine cytokine proteins and the effect of canine cytokine neutralization by Ab. Starting with recombinant canine (rcan) IL-1beta and rcanTNF, four polyclonal antisera and 22 mAb specific for rcanIL-1beta and rcanTNF were generated. Their usefulness in neutralization assays was determined. Using cytokine-containing supernatants of canine cells in bioassays, polyclonal antisera neutralized either canine IL-1beta or TNF. TNF was also neutralized by three antibodies developed in this study and one commercial mAb. The usefulness of monoclonal and polyclonal Ab in canine cytokine-specific Ab capture ELISA's was assessed. This resulted in the identification of a commercial mAb combination and one pair developed in this study allowing low levels of TNF to be detected by antibody capture ELISA. The detection limit was 141 pg/ml rcanTNF for both combinations. Using rcanIL-1beta as an antigen allowed the detection of lower concentrations of rcanIL-1beta (20 pg/ml, on the average) by a pair of polyclonal antisera than when monoclonals were used. By using such IL-1beta-specific and TNF-specific ELISA's, the respective cytokines were detected in supernatants of canine PBMC stimulated with LPS or heat-killed Listeria monocytogenes and interferon-gamma combined. Thus, monoclonal and polyclonal reagents were identified allowing the quantitation of canine IL-1beta and TNF production in vitro, and the neutralization of these cytokines.

Detection and quantification of leptospires in urine of dogs: a maintenance host for the zoonotic disease leptospirosis.

Leptospirosis is a global zoonotic disease. Pathogenic Leptospira species, the causative agent of leptospirosis, colonize the renal tubules of chronically infected maintenance hosts such as dogs, rats and cattle. Maintenance hosts typically remain clinically asymptomatic and shed leptospires into the environment via urine. In contrast, accidental hosts such as humans can suffer severe acute forms of the disease. Infection results from direct contact with infected urine or indirectly, through contaminated water sources. In this study, a quantitative real-time PCR specific for lipL32 was designed to detect the urinary shedding of leptospires from dogs. The sensitivity and specificity of the assay was evaluated using both a panel of pathogenic Leptospira species and clinical microbial isolates, and samples of urine collected from experimentally infected rats and non-infected controls. The lower limit of detection was approximately 3 genome equivalents per reaction. The assay was applied to canine urine samples collected from local dog sanctuaries and the University Veterinary Hospital (UVH) at University College Dublin. Of 525 canine urine samples assayed, 37 were positive, indicating a prevalence of urinary shedding of leptospires of 7.05%. These results highlight the need to provide effective canine vaccination strategies and raise public health awareness.

Immunohistochemical detection of IgM and IgG in lung tissue of dogs with leptospiral pulmonary haemorrhage syndrome (LPHS).

Leptospiral pulmonary haemorrhage syndrome (LPHS) is a severe form of leptospirosis. Pathogenic mechanisms are poorly understood. Lung tissues from 26 dogs with LPHS, 5 dogs with pulmonary haemorrhage due to other causes and 6 healthy lungs were labelled for IgG (n=26), IgM (n=25) and leptospiral antigens (n=26). Three general staining patterns for IgG/IgM were observed in lungs of dogs with LPHS with most tissues showing more than one staining pattern: (1) alveolar septal wall staining, (2) staining favouring alveolar surfaces and (3) staining of intra-alveolar fluid. Healthy control lung showed no staining, whereas haemorrhagic lung from dogs not infected with Leptospira showed staining of intra-alveolar fluid and occasionally alveolar septa. Leptospiral antigens were not detected. We conclude that deposition of IgG/IgM is demonstrable in the majority of canine lungs with naturally occurring LPHS, similar to what has been described in other species. Our findings suggest involvement of the host humoral immunity in the pathogenesis of LPHS and provide further evidence to support the dog as a natural disease model for human LPHS.

Analytic validation of a gas chromatography-mass spectrometry method for quantification of six amino acids in canine serum samples.

OBJECTIVE To analytically validate a gas concentration of chromatography-mass spectrometry (GC-MS) method for measurement of 6 amino acids in canine serum samples and to assess the stability of each amino acid after sample storage. SAMPLES Surplus serum from 80 canine samples submitted to the Gastrointestinal Laboratory at Texas A&M University and serum samples from 12 healthy dogs. PROCEDURES GC-MS was validated to determine precision, reproducibility, limit of detection, and percentage recovery of known added concentrations of 6 amino acids in surplus serum samples. Amino acid concentrations in serum samples from healthy dogs were measured before (baseline) and after storage in various conditions. RESULTS Intra- and interassay coefficients of variation (10 replicates involving 12 pooled serum samples) were 13.4% and 16.6% for glycine, 9.3% and 12.4% for glutamic acid, 5.1% and 6.3% for methionine, 14.0% and 15.1% for tryptophan, 6.2% and 11.0% for tyrosine, and 7.4% and 12.4% for lysine, respectively. Observed-to-expected concentration ratios in dilutional parallelism tests (6 replicates involving 6 pooled serum samples) were 79.5% to 111.5% for glycine, 80.9% to 123.0% for glutamic acid, 77.8% to 111.0% for methionine, 85.2% to 98.0% for tryptophan, 79.4% to 115.0% for tyrosine, and 79.4% to 110.0% for lysine. No amino acid concentration changed significantly from baseline after serum sample storage at -80°C for ≤ 7 days. CONCLUSIONS AND CLINICAL RELEVANCE GC-MS measurement of concentration of 6 amino acids in canine serum samples yielded precise, accurate, and reproducible results. Sample storage at -80°C for 1 week had no effect on GC-MS results.

Validation of an enzyme-linked immunosorbent assay (ELISA) for the measurement of canine S100A12.

BACKGROUND Canine S100 calcium-binding protein A12 (cS100A12) shows promise as biomarker of inflammation in dogs. A previously developed cS100A12-radioimmunoassay (RIA) requires radioactive tracers and is not sensitive enough for fecal cS100A12 concentrations in 79% of tested healthy dogs. An ELISA assay may be more sensitive than RIA and does not require radioactive tracers. OBJECTIVE The purpose of the study was to establish a sandwich ELISA for serum and fecal cS100A12, and to establish reference intervals (RI) for normal healthy canine serum and feces. METHODS Polyclonal rabbit anti-cS100A12 antibodies were generated and tested by Western blotting and immunohistochemistry. A sandwich ELISA was developed and validated, including accuracy and precision, and agreement with cS100A12-RIA. The RI, stability, and biologic variation in fecal cS100A12, and the effect of corticosteroids on serum cS100A12 were evaluated. RESULTS Lower detection limits were 5 μg/L (serum) and 1 ng/g (fecal), respectively. Intra- and inter-assay coefficients of variation were ≤ 4.4% and ≤ 10.9%, respectively. Observed-to-expected ratios for linearity and spiking recovery were 98.2 ± 9.8% (mean ± SD) and 93.0 ± 6.1%, respectively. There was a significant bias between the ELISA and the RIA. The RI was 49-320 μg/L for serum and 2-484 ng/g for fecal cS100A12. Fecal cS100A12 was stable for 7 days at 23, 4, -20, and -80°C; biologic variation was negligible but variation within one fecal sample was significant. Corticosteroid treatment had no clinically significant effect on serum cS100A12 concentrations. CONCLUSIONS The cS100A12-ELISA is a precise and accurate assay for serum and fecal cS100A12 in dogs.

Development of a dynamic headspace concentration technique for the non-contact sampling of human odor samples and the creation of canine training aids

Human scent and human remains detection canines are used to locate living or deceased humans under many circumstances. Human scent canines locate individual humans on the basis of their unique scent profile, while human remains detection canines locate the general scent of decomposing human remains. Scent evidence is often collected by law enforcement agencies using a Scent Transfer Unit, a dynamic headspace concentration device. The goals of this research were to evaluate the STU-100 for the collection of human scent samples, and to apply this method to the collection of living and deceased human samples, and to the creation of canine training aids. The airflow rate and collection material used with the STU-100 were evaluated using a novel scent delivery method. Controlled Odor Mimic Permeation Systems were created containing representative standard compounds delivered at known rates, improving the reproducibility of optimization experiments. Flow rates and collection materials were compared. Higher air flow rates usually yielded significantly less total volatile compounds due to compound breakthrough through the collection material. Collection from polymer and cellulose-based materials demonstrated that the molecular backbone of the material is a factor in the trapping and releasing of compounds. The weave of the material also affects compound collection, as those materials with a tighter weave demonstrated enhanced collection efficiencies. Using the optimized method, volatiles were efficiently collected from living and deceased humans. Replicates of the living human samples showed good reproducibility; however, the odor profiles from individuals were not always distinguishable from one another. Analysis of the human remains samples revealed similarity in the type and ratio of compounds. Two types of prototype training aids were developed utilizing combinations of pure compounds as well as volatiles from actual human samples concentrated onto sorbents, which were subsequently used in field tests. The pseudo scent aids had moderate success in field tests, and the Odor pad aids had significant success. This research demonstrates that the STU-100 is a valuable tool for dog handlers and as a field instrument; however, modifications are warranted in order to improve its performance as a method for instrumental detection.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Masticatory afficiency in denture wearers with bilateral balanced occlusion and canine guidance

The maintenance of masticatory function is especially important for patients wearing complete dentures due to their limitations. Thus, the bilateral balanced occlusal concept is used to achieve greater masticatory efficiency. However, a critical review of the literature reveals that there is not sufficient scientific evidence to support bilateral balanced occlusion as the most appropriate occlusal concept in complete dentures. Therefore, the aim of this study was to evaluate the masticatory efficiency in complete dentures wearers with bilateral balanced occlusion and canine guidance. A double-blinded controlled crossover clinical trial was conducted. The sample was composed by 24 edentulous patients who wore sets of complete dentures with both occlusal concepts during equal periods of 3 months. Objective data were collected through the masticatory efficiency test performed by the colorimetric method with the beads, in which capsules of a synthetic material enclosing fuchsine-containing granules were used. Subjective data were recorded by patient's ratings of their chewing function. No significant statistical difference was found for masticatory efficiency (p=0.095) between the two occlusal concepts studied. The results suggest that bilateral balanced occlusion does not improve the masticatory efficiency in complete denture wearers.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.