Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

The biomechanics of amnion rupture: an X-ray diffraction study

Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

The anions [(ZrOH(CO3)3)2]6− and [(ZrOH(C2O4)3)2]6−: single crystal X-ray diffraction studies of the complexes guanidinium zirconium carbonate [(C(NH2)3)3ZrOH(CO3)3·H2O]2 and sodium zirconium oxalate Na6(ZrOH(C2O4)3)2·7H2O

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.

Reactions of methylvinyl and phenylvinyl ketones with a tricyclic ketone derived from 2-tetralone: characterization of crystalline products by X-ray diffraction

Base catalysed reaction of the tricyclic ketone (6 ⇌ 7) with methylvinyl ketone gave the tetracyclic ketols, 11, 13, 15, 16, and the pentacyclic ketols, 12, 17. With phenylvinyl ketone, the tetracyclic ketol (18) was formed. The stereostructures of the ketols were identified by X-Ray diffraction. The base-catalysed title reactions gave the cyclic ketols and derived compounds shown below whose structures were identified by X-ray diffraction.

Reaction of (±)-1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-phosH} with copper(II), cobalt(II) and iron(II) compounds; Identification by x-ray diffraction of [Co(CH3OH)4(H2O)2][(+)-phos][(−)-phos]. 2CH3OH·H2O

[Cu2(μO2CCH3)4(H2O)2], [CuCO3·Cu(OH)2], [CoSO4·7H2O], [Co((+)-tartrate)], and [FeSO4·7H2O] react with excess racemic (±)- 1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-PhosH} to give mononuclear CuII, CoII and FeII products. The cobalt product, [Co(CH3OH)4(H2O)2]((+)-Phos)((−)-Phos) ·2CH3OH·H2O (7), has been identified by X-ray diffraction. The high-spin, octahedral CoII atom is ligated by four equatorial methanol molecules and two axial water molecules. A (+)- and a (−)-Phos− ion are associated with each molecule of the complex but are not coordinated to the metal centre. For the other CoII, CuII and FeII samples of similar formulation to (7) it is also thought that the Phos− ions are not bonded directly to the metal. When some of the CuII and CoII samples are heated under high vacuum there is evidence that the Phos− ions are coordinated directly to the metals in the products.

X-ray diffraction study of the influence of temperature on the structural correlations of poly(2-hydroxypropyl ether of bisphenol A)

The X-ray diffraction pattern of glassy poly(2-hydroxypropyl ether of bisphenol A) is studied at room temperature on oriented samples in order to associate its different peaks to different structural correlations. On the other hand, X-ray diffraction patterns have been obtained at different temperatures from Tg − 50 K up to Tg + 50 K for the above-mentioned polymer. Attention has been paid to the evolution with temperature of the position of the wide diffraction maximum corresponding to interchain correlations in the polymer. The temperature evolution of this parameter shows a marked discontinuity just at the glass transition temperature.

Preventing carbon contamination of optical devices for X-rays: the effect of oxygen on photon-induced dissociation of CO on platinum

Platinum is one of the most common coatings used to optimize mirror reflectivity in soft X-ray beamlines. Normal operation results in optics contamination by carbon-based molecules present in the residual vacuum of the beamlines. The reflectivity reduction induced by a carbon layer at the mirror surface is a major problem in synchrotron radiation sources. A time-dependent photoelectron spectroscopy study of the chemical reactions which take place at the Pt(111) surface under operating conditions is presented. It is shown that the carbon contamination layer growth can be stopped and reversed by low partial pressures of oxygen for optics operated in intense photon beams at liquidnitrogen temperature. For mirrors operated at room temperature the carbon contamination observed for equivalent partial pressures of CO is reduced and the effects of oxygen are observed on a long time scale.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Genotoxic effects of X-rays on keratinized mucosa cells during panoramic dental radiography

Objectives: The aim of this study was to evaluate the genotoxic effects of X-rays on epithelial gingival cells during panoramic dental radiography using a differentiated protocol for the micronucleus test. Methods: 40 healthy individuals who underwent this procedure for diagnostic purposes on request from their dentists agreed to participate in this study. All of them answered a questionnaire before the examination. Epithelial gingival cells were obtained from the keratinized mucosa of the upper dental arcade by gentle scraping with a cervical brush immediately before exposure and 10 days later. Cytological preparations were stained according to the Feulgen-Rossenbeck reaction, counterstained with fast green 1% for 1 min and analysed under a light microscope. Micronuclei, nuclear projections (broken eggs) and degenerative nuclear alterations (pyknosis, karyolysis, karyorrhexis and condensed chromatin) were scored. Results: The frequency of micronuclei was significantly higher after exposure (P < 0.05), as were frequencies of nuclear alterations indicate of apoptosis (P < 0.001). Conclusions: These results indicate that X-ray radiation emitted during panoramic dental radiography induces a genotoxic effect on epithelial gingival cells that increases the frequency of chromosomal damage and nuclear alterations indicative of apoptosis.

Influence of quantum-dots density on average in-plane strain of optoelectronic devices investigated by high-resolution X-ray diffraction

High-resolution X-ray diffractometry is used to probe the nature of a diffraction-peak broadening previously noticed in quantum dots (QDs) systems with freestanding InAs islands on top of GaAs (001) substrates [Freitas et al., Phys. Status Solidi (A) 204, 2548 (2007)]. The procedure is hence extended to further investigate the capping process of InAs/GaAs QDs. A direct correlation is established between QDs growth rates and misorientation of lattice-planes at the samples surfaces. This effect provides an alternative too] for studying average strain fields on QDs systems in standard triple axis diffractometers running on X-ray tube sources, which are much more common than synchrotron facilities. (C) 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

MAGNETIC RESONANT X-RAY DIFFRACTION APPLIED TO THE STUDY OF EuTe FILMS AND MULTILAYERS

In this work we use magnetic resonant x-ray diffraction to study the magnetic properties of a 1.5 mu m EuTe film and an EuTe/PbTe superlattice (SL). The samples were grown by molecular beam epitaxy on (111) oriented BaF(2) substrates. The measurements were made at the Eu L(2) absorption edge, taking profit of the resonant enhancement of more than two orders in the magnetically diffracted intensity. At resonance, high counting rates above 11000 cps were obtained for the 1.5 gm EuTe film, allowing to check for the type II antiferromagnetic order of EuTe. An equal population of the three possible in-plane magnetic domains was found. The EuTe/PbTe SL magnetic peak showed a satellite structure, indicating the presence of magnetic correlations among the 5 ML (monolayers) EuTe layers across the 15 ML PbTe non-magnetic spacers. The temperature dependence of the integrated intensities of the film and the SL yielded different Neel temperatures T(N). The lower T(N) for the SL is explained considering the higher influence of the surface atoms, with partial bonds lost.

In situ X-ray diffraction studies of phase transition in Pb1-x La x Zr0.40Ti0.60O3 ferroelectric ceramics

The temperature dependence of the crystalline structure and the lattice parameters of Pb1-xLaxZr0.40Ti0.60O3 ferroelectric ceramic system with 0.00 x 0.21 was determined. The samples with x 0.11 show a cubic-to-tetragonal phase transition at the maximum dielectric permittivity, Tmax. Above this amount and especially for the x = 0.12 sample, a spontaneous phase transition from a relaxor ferroelectric state (cubic phase) to a ferroelectric state (tetragonal phase) is observed upon cooling below the Tmax. Unlike what has been reported in other studies, the x = 0.13, 0.14, and 0.15 samples, which present a more pronounced relaxor behavior, also presents a spontaneous normal-to-relaxor transition, indicated by a cubic to tetragonal symmetry below the Tmax. The origin of this anomaly has been associated with an increase in the degree of tetragonality, confirmed by the measurements of the X-ray diffraction patterns. The differential thermal analysis (DSC) measurements also confirm the existence of these phase transitions.

New Ni(II)-sulfonamide complexes: Synthesis, structural characterization and antibacterial properties. X-ray diffraction of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)]

The synthesis, structural characterization, voltammetric experiments and antibacterial activity of [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] were studied and compared with similar previously reported copper complexes. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O crystallized in a monoclinic system, space group C2/c where the nickel ion was in a slightly distorted octahedral environment, coordinated with two sulfisoxazole molecules through the heterocyclic nitrogen and four water molecules. [Ni(sulfapyridine)(2)] crystallized in a orthorhombic crystal system, space group Pnab. The nickel ion was in a distorted octahedral environment, coordinated by two aryl amine N from two sulfonamides acting as monodentate ligands and four N atoms (two sulfonamidic N and two heterocyclic N) from two different sulfonamide molecules acting as bidentate ligands. Differential pulse voltammograms were recorded showing irreversible peaks at 1040 and 1070 mV, respectively, attributed to Ni(II)/Ni(III) process. [Ni(sulfisoxazole)(2)(H2O)(4)] center dot 2H(2)O and [Ni(sulfapyridine)(2)] presented different antibacterial behavior against Staphylococcus aureus and Escherichia coli from the similar copper complexes and they were inactive against Mycobacterium tuberculosis. (c) 2007 Elsevier Inc. All rights reserved.