Luminescence properties of the Langmuir-Blodgett film of terbium(III) stearoylanthranilate

Terbium(III) stearoylanthranilate has been prepared as a high property Z-type Langmuir-Blodgett (LB) film on various substrates by a vertical transfer process. The UV-visible absorption spectra and the low angle X-ray diffraction peaks have been collected in order to investigate the molecular arrangement and aggregation in the LB films. The average molecular orientation in multilayer stacking was determined by Attenuated Total Reflection Spectroscopy. The influence of the chemical environment of terbium within the LB films on the luminescence properties has been discussed. (C) 1997 Elsevier Science S.A.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

SERS enhancement by aggregated Au colloids: effect of particle size

Aggregated Au colloids have been widely used as SERS enhancing media for many years but to date there has been no systematic investigation of the effect of the particle size on the enhancements given by simple aggregated Au colloid solutions. Previous systematic studies on isolated particles in solution or multiple particles deposited onto surfaces reported widely different optimum particle sizes for the same excitation wavelength and also disagreed on the extent to which surface plasmon absorption spectra were a good predictor of enhancement factors. In this work the spectroscopic properties of a range of samples of monodisperse Au colloids with diameters ranging from 21 to 146 nm have been investigated in solution. The UV/visible absorption spectra of the colloids show complex changes as a function of aggregating salt (MgSO4) concentration which diminish when the colloid is fully aggregated. Under these conditions, the relative SERS enhancements provided by the variously sized colloids vary very significantly across the size range. The largest signals in the raw data are observed for 46 nm colloids but correction for the total surface area available to generate enhancement shows that particles with 74 nm diameter give the largest enhancement per unit surface area. The observed enhancements do not correlate with absorbance at the excitation wavelength but the large differences between differently sized colloids demonstrate that even in the randomly aggregated particle assemblies studied here, inhomogeneous broadening does not mask the underlying changes due to differences in particle diameter.

Fabrication of cerium oxide nanoparticles: Characterization and optical properties

Ceria (CeO2) is a technologically important rare earth material because of its unique properties and various engineering and biological applications. A facile and rapid method has been developed to prepare ceria nanoparticles using microwave with the average size 7 nm in the presence of a set of ionic liquids based on the bis (trifluoromethylsulfonyl) imide anion and different cations of 1-alkyl-3-methyl-imidazolium. The structural features and optical properties of the nanoparticles were determined in depth with X-ray powder diffraction, transmission electron microscope, N-2 adsorption-desorption technique, dynamic light scattering (DLS) analysis, FTIR spectroscopy, Raman spectroscopy, UV-vis absorption spectroscopy, and Diffuse reflectance spectroscopy. The energy band gap measurements of nanoparticles of ceria have been carried out by UV-visible absorption spectroscopy and diffuse reflectance spectroscopy. The surface charge properties of colloidal ceria dispersions in ethylene glycol have been also studied. To the best of our knowledge, this is the first report on using this type of ionic liquids in ceria nanoparticle synthesis. (C) 2011 Elsevier Inc. All rights reserved.

A comprehensive aerosol spray method for the rapid photocatalytic grid area analysis of semiconductor photocatalyst thin films

Indicator inks, previously shown to be capable of rapidly assessing photocatalytic activity via a novel photo-reductive mechanism, were simply applied via an aerosol spray onto commercially available pieces of Activ (TM) self-cleaning glass. Ink layers could be applied with high evenness of spread, with as little deviation as 5% upon UV-visible spectroscopic assessment of 25 equally distributed positions over a 10 cm x 10 cm glass cut. The inks were comprised of either a resazurin (Rz) or dichloroindophenol (DCIP) redox dye with a glycerol sacrificial electron donor in an aqueous hydroxyethyl cellulose (HEC) polymer media. The photo-reduction reaction under UVA light of a single spot was monitored by UV-vis spectroscopy and digital images attained from a flat-bed scanner in tandem for both inks. The photo-reduction of Rz ink underwent a two-step kinetic process, whereby the blue redox dye was initially reduced to a pink intermediate resorufin (Rf) and subsequently reduced to a bleached form of the dye. In contrast, a simple one-step kinetic process was observed for the reduction of the light blue redox dye DCIP to its bleached intermediates. Changes in red-green-blue colour extracted from digital images of the inks were inversely proportional to the changes seen at corresponding wavelengths via UV-visible absorption spectroscopy and wholly indicative of the reaction kinetics. The photocatalytic activity areas of cuts of Activ (TM) glass, 10 cm x 10 cm in size, were assessed using both Rz and DCIP indicator inks evenly sprayed over the films: firstly using UVA lamp light to activate the underlying Activ (TM) film (1.75 mW cm(-2)) and secondly under solar conditions (2.06 +/- 0.14 mW cm(-2)). The photo-reduction reactions were monitored solely by flat-bed digital scanning. Red-green-blue values of a generated 14 x 14 grid (196 positions) that covered the entire area of each film image were extracted using a Custom-built program entitled RGB Extractor(C). A homogenous degradation over the 196 positions analysed for both Rz (Red colour deviation = 19% UVA, 8% Solar: Green colour deviation = 17% UVA, 12% Solar) and DCIP (Red colour deviation = 22% UVA, 16% Solar) inks was seen in both UVA and solar experiments, demonstrating the consistency of the self-cleaning titania layer on Activ (TM). The method presented provides a good solution for the high-throughput photocatalytic screening of a number of homogenous photocatalytically active materials simultaneously or numerous positions on a single film; both useful in assessing the homogeneity of a film or determining the best combination of reaction components to produce the optimum performance photocatalytic film. (C) 2010 Elsevier B.V. All rights reserved.

Simple method for the rapid simultaneous screening of photocatalytic activity over multiple positions of self-cleaning films

An intelligent ink, previously shown to be capable of rapidly assessing photocatalytic activity, was simply applied via a felt-pen onto a commercially available piece of Activ (TM) self-cleaning glass. The ink, comprising of redox dye resazurin and the sacrificial electron donor glycerol within an aqueous hydroxy ethyl cellulose (HEC) polymer media, was photocatalytically degraded in a two-step process. The key initial stage was the photo-reductive conversion of resazurin to resorufin, whereby a colour change from blue to pink occurred. The latter stage was the subsequent photo-reduction of the resorufin, where a slower change from pink to colourless was seen. Red and green components of red-green-blue colour extracted from flat-bed scanner digital images of resazurin ink coated photocatalytic films at intervals during the photocatalysis reaction were inversely proportional to the changes seen via UV-visible absorption spectroscopy and indicative of reaction kinetics. A 3 x 3 grid of intelligent ink was drawn onto a piece of Activ (TM) and a glass blank. The photocatalysis reaction was monitored solely by flat-bed digital scanning. Red-green-blue values of respective positions on the grid were extracted using a custom-built program entitled RGB Extractor (c). The program was capable of extracting a number of 5 x 5 pixel averages of red-green-blue components simultaneously. Allocation of merely three coordinates allowed for the automatic generation of a grid, with scroll-bars controlling the number of positions to be extracted on the grid formed. No significant change in red and green components for any position on the glass blank was observed; however, the Activ (TM) film displayed a homogenous photo-reduction of the dye, reaching maxima in red and minima in green components in 23 +/- 3 and 14 +/- 2 min, respectively. A compositionally graded N-doped titania film synthesised in house via a combinatorial APCVD reaction was also photocatalytically tested by this method where 247 positions on a 13 x 19 grid were simultaneously analysed. The dramatic variation in photocatalysis observed was rapidly quantified for all positions (2-3 hours) allowing for correlations to be made between thicknesses and N : Ti% compositions attained from Swanepoel and WDX analysis, respectively. N incorporation within this system was found to be detrimental to film activity for the photocatalysis reaction of intelligent ink under 365 nm light.

Études spectroscopiques expérimentales et théoriques de complexes de métaux de transition

Cette thèse présente une série d'études qui visent la compréhension de la structure électronique de complexes de métaux de transition en employant diverses méthodes de spectroscopie. L'information sur la structure électronique aide à comprendre et développer des nouveaux matériaux, des nouvelles voies de synthèses, ainsi que des nouveaux modèles théoriques. Habituellement, afin d'explorer la structure électronique d'un système qui comporte en son centre un métal de transition, l'information fournie par les spectres d'un seul composé n'est pas suffisante. On étudie une série de composés similaires, qui ont le même métal de transition à un degré d'oxydation donné, ainsi que des ligands qui forment des liaisons de différentes forces et caractéristiques avec le métal. Cependant, ces changements, bien qu'on les désire de faible impact, créent une grande perturbation de la structure électronique visée par les études. Afin d'étudier en profondeur une seule structure électronique, nous employons une stratégie d'analyse moins perturbante. Nous appliquons une pression hydrostatique sur les complexes de métaux de transition. Cette pression perturbe le système suffisamment pour nous livrer davantage d'informations sur la structure électronique, sans la « dénaturer ». Afin d'étudier précisément ces systèmes perturbés, la technique d'application de pression est conjuguée, dans la littérature, aux diverses techniques de spectroscopie d'absorption UV-visible, de luminescence, ainsi que de diffusion Raman. Pour extraire un maximum d'informations de ces expériences, on emploie des techniques de calculs de structure électronique ainsi que de dynamique des noyaux. Dans cette thèse, on tente de mettre en lumière la structure électronique de composés de molybdène(IV), de platine(II) et palladium(II) à l'aide de la technique de pression couplée aux spectroscopies de luminescence et de diffusion Raman. Dans le chapitre 3, on observe un déplacement de la bande de luminescence de +12 cm-1/kbar entre la pression ambiante et 25 kbar pour le complexe trans-[MoOCl(CN-t-Bu)4]BPh4, dont le centre métallique molybdène(IV)est de configuration électronique 4d2. Il s'agit de la première variation positive observée pour un complexe de type métal-oxo. À des pressions plus élevées, la tendance s'inverse. Le maximum d'énergie de la bande de luminescence se déplace de -8 cm-1/kbar. Ce changement de variation présage d'une compétition interne entre les ligands situés sur les différents axes de l'octaèdre. À l'aide de calculs basés sur la théorie de la fonctionnelle de la densité, on propose un mécanisme pour expliquer ce phénomène. Au cours du chapitre 4, on étudie des complexes de palladium(II) et de platine(II) qui ont les mêmes ligands. Un de ces ligands est le 1,4,7-trithiacyclononane (ttcn). On constate qu'à basse pression le ligand est bidentate. Par contre, lorsque la pression augmente, on constate, par exemple à l'aide du complexe [Pt(ttcn)Cl2], qu'une interaction anti-liante supplémentaire se produit entre le ligand ttcn et le métal, ce qui change la nature de l'orbitale HOMO. On observe un déplacement de la bande de luminescence de -19 cm-1/kbar. Tel que pour le complexe de molybdène(IV), le déplacement de la bande de luminescence dépend de la compétition entre les ligands situés sur les différents axes de l'octaèdre. L'interaction liante entre l'ion platine(II) et l'atome de soufre axial est l'effet le plus plausible qui peut induire un déplacement de la bande de luminescence vers les basses énergies. Ceci nous indique que cette interaction domine. Par contre, pour ce qui est du complexe palladium(II), la compétition est remportée par d'autres effets, car le déplacement de la bande de luminescence est de +6 cm-1/kbar. Encore une fois, des calculs, basés sur la théorie de la fonctionnelle de la densité, aident à explorer les causes de ces observations en suggérant des explications corroborées simultanément par les diverses expériences de spectroscopie. Lors du chapitre 5, une étude plus exacte de la structure électronique ainsi que de la dynamique des noyaux de complexes de métaux de transition est présentée. En effet, les complexes de palladium(II) et de platine(II), de type [M(X)4]2-, ont une structure simple, très symétrique. Le premier état excité de ces molécules subit la distorsion Jahn-Teller. On veut établir un protocole de travail pour les expérimentateurs afin d'analyser des spectres de molécules pour lesquelles l'approximation de Born-Oppenheimer n'est pas valide. On utilise la théorie de la fonctionnelle de la densité dépendante du temps ainsi que le modèle de Heidelberg afin de décrire des effets non adiabatique. On tente d'établir l'influence des effets non adiabatiques sur les spectres de ce type de complexe.

Langmuir and Langmuir-Blodgett (LB) films of poly [(2-methoxy,5-n-octadecyl)-p-phenylenevinylene] (OC1OC18-PPV)

A PPV derivative, poly(2-methoxy,5-(n-octadecyl)-p-phenylenevinylene) (OC1OC18-PPV), has been synthesized via the Gilch route and used to fabricate Langmuir and Langmuir-Blodgett (LB) films. True monomolecular films were formed at the air/water interface, which were successfully transferred onto different types of substrate. Using UV-visible absorption, FTIR, fluorescence and Raman scattering spectroscopies we observed that the polymer molecules were randomly distributed in the LB film, with no detectable anisotropy. This is in contrast to the anisotropic LB films of a previously reported PPV derivative, poly(2-methoxy-5-n-hexyloxy)-p-phenylenevinylene (OC1OC6-PPV), which is surprising because the longer chain of OC1OC18-PPV investigated here was expected to lead to more ordered films. As a consequence of the lack of order, LB films of OC1OC18-PPV exhibit lower photoconductivity and require higher operating voltage in a polymer light-emitting diode (PLED) in comparison with LB films of OC1OC6-PPV. This result confirms the importance of molecular organization in the LB film to obtain efficient PLEDs. (c) 2005 Elsevier Ltd. All rights reserved.

Desenvolvimento de um novo complexo macrocíclico do sistema cobalto cyclam

In this work were synthesized and studied the spectroscopic and electrochemical characteristics of the coordination compounds trans-[Co (cyclam)Cl2]Cl, trans- Na[Co(cyclam)(tios)2], trans-[Co(en)2Cl2]Cl and trans-Na[Co(en)2(tios)2], where tios = thiosulfate and en = ethylenediamine. The compounds were characterized by: Elemental Analysis (CHN), Absorption Spectroscopy in the Infrared (IR), Uv-Visible Absorption Spectroscopy, Luminescence Spectroscopy and Electrochemistry (cyclic voltammetry). Elemental Analysis (CHN) suggests the following structures for the complex: trans- [Co(cyclam)Cl2]Cl.6H2O and trans-Na[Co(cyclam)(tios)2].7H2O. The electrochemical analysis, when compared the cathodic potential (Ec) processes of the complexes trans- [Co(cyclam)Cl2]Cl and trans-[Co(en)2Cl2]Cl, indicated a more negative value (-655 mV) for the second complex, suggesting a greater electron donation to the metal center in this complex which can be attributed to a greater proximity of the nitrogen atoms of ethylenediamine in relation to metal-nitrogen cyclam. Due to the effect of setting macrocyclic ring to the metal center, the metal-nitrogen bound in the cyclam are not as close as the ethylenediamine, this fact became these two ligands different. Similar behavior is also observed for complexes in which the chlorides are replaced by thiosulfate ligand, trans-Na[Co(en)2(tios)2] (-640 mV) and trans-Na[Co(cyclam)(tios)2] (-376 mV). In absorption spectroscopy in the UV-visible, there is the band of charge transfer LMCT (ligand p d* the metal) in the trans-Na[Co(cyclam)(tios)2] (350 nm, p tios  d* Co3+) and in the trans-Na[Co(en)2(tios)2] (333 nm, p tios d* Co3+), that present higher wavelength compared to complex precursor trans- [Co(cyclam)Cl2]Cl (318 nm, pCl  d* Co3+), indicating a facility of electron density transfer for the metal in the complex with the thiosulfate ligand. The infrared analysis showed the coordination of the thiosulfate ligand to the metal by bands in the region (620-635 cm-1), features that prove the monodentate coordination via the sulfur atom. The νN-H bands of the complexes with ethylenediamine are (3283 and 3267 cm-1) and the complex with cyclam bands are (3213 and 3133 cm-1). The luminescence spectrum of the trans-Na[Co(cyclam)(tios)2] present charge transfer band at 397 nm and bands dd at 438, 450, 467, 481 and 492 nm.

Evaluation of Brazilian woods as an alternative to oak for cachacas aging

Cachaca was aged for 6 months in small casks of oak and eight different Brazilian woods (amarelo, amendoim, balsamo, jatoba, louro, pau d'arco, pau d'oleo, and pereiro) in order to determine total phenols, UV-visible spectra differences, and sensorial acceptance. Also used were 200-l casks of oak and pereiro for aging cachaca for 4 years to characterize sensorial descriptors and acceptance. The results suggest that amendoim and pereiro followed by jatobaa are good candidates to replace oak in the construction of cachaca aging casks. It was also observed that when using oak casks as a standard the major changes in the sensory properties occurred in the first 21 months of aging. The principal components analysis of UV-visible absorption spectra of the same beverage stored in casks made of different woods allowed identification of the wood in which the beverage had been aged.

Multi-spectroscopic monitoring of cisplatin-derived species delivery from ureasil polyether hybrid matrix

Driven by the challenges involved in the development of new advanced materials with unusual drug delivery profiles capable of improving the therapeutic and toxicological properties of existing cancer chemotherapy, the one-pot sol-gel synthesis of flexible, transparent and insoluble urea-cross-linked polyether-siloxane hybrids has been recently developed. In this one-pot synthesis, the strong interaction between the antitumor cisplatin (CisPt) molecules and the ureasil-poly(propylene oxide) (PPO) hybrid matrix gives rise to the incorporation and release of an unknown CisPt-derived species, hindering the quantitative determination of the drug release pattern from the conventional UV-Vis absorption technique. In this article, we report the use of an original synchrotron radiation calibration method based on the combination of XAS and UV-Vis for the quantitative determination of the amount of Pt-based molecules released in water. Thanks to the combination of UV-Vis, XAS and Raman techniques, we demonstrated that both the CisPt molecules and the CisPt-derived species are loaded into an ureasil-PPO/ureasil-poly(ethylene oxide) (PEO) hybrid blend matrix. The experimentally determined molar extinction coefficient of the CisPt-derived species loaded into ureasil-PPO hybrid matrix enabled the simultaneous time-resolved monitoring of each Pt species released from this hybrid blend matrix.

From sol to aerogel: a study of the nanostructural characteristics of TEOS derived sonogels

The nanostructural characteristics of acid-catalyzed sonogels are studied along the aging process at 60 degreesC in saturated conditions and after the CO, supercritical extraction (aerogel). The structural evolution was studied by means of small-angle X-ray scattering (SAXS) and UV-Visible absorption techniques. The sonogel exhibits a mass fractal structure in a length scale between zeta - 1/q(0) similar to 5.3 and a(1) similar to 1/q(m) similar to 0.22 nm, as the length scale probed by SAXS. The apparent mass fractal dimension lightly increases from 2.0 for fresh gel until 2.2 for 14 days aging in wet conditions. The UV absorption also increases with the aging time in wet conditions. Both observations are consistent with the syneresis process accompanying the polycondensation progress during aging in saturated conditions. For long aging times, the wet sonogels show a light transition from a mass to a surface fractal. in a very small interval of the length scale, developing an extremely rough surface with fractal dimension D-S similar to 2.9, the fractal characteristics of the sonogels practically do not change with the alcohol exchange. With the CO2 supercritical extraction (aerogel). The interval in the length scale in which the surface fractal is defined increases, while the surface fractal dimension diminishes to D-S similar to 2.5. The mass fractal characteristics are less apparent in the aerogels. (C) 2001 Elsevier B.V. B.V. All rights reserved.

Surface pressure-area isotherms for Langmuir monolayers and a docking molecular orientation of perylene tetracarboxylic derivatives on a water surface

The surface pressure-molecular area (pi-A) isotherms for Langmuir monolayers of four perylenetetracarboxylic (PTCD) derivatives, measured with varying subphase temperatures and compression speeds, are reported. The behavior of these PTCD derivatives at the water-air interface is modeled using the rigid docking method. This approach is the first attempt to model the molecular orientation of PTCD on the water surface to be compared with experimental Langmuir isotherms. Through this methodology, it would be possible to anticipate aggregation and determine if favorable spatial orientations of perylenes are generated on the water surface. The pi-A isotherm experiments show that these molecules can support high surface pressures, indicating strong packing on the water surface and that the isotherms are compression speed independent but temperature dependent. The molecular orientation and stacking was further examined in Langmuir-Blodgett (LB) monolayers deposited onto glass and glass coated with Ag island films using UV-visible absorption and surface-enhanced fluorescence (SEF) measurements.

Propriedades estruturais de géis obtidos a partir de sono-hidrólise de TEOS e troca de fase líquida por acetona

Pós-graduação em Física - IGCE

Blendas de PVC/PCL foto/termo e biotratadas com fungos de solo (Phanerochaete chrysosporium e Aspergillus fumigatus)

Pós-graduação em Ciências Biológicas (Microbiologia Aplicada) - IBRC