883 resultados para Sensitive variable
Resumo:
To investigate the ability of pioneer and late-successional species to adapt to a strong light environment in a reforestation area, we examined the activities of antioxidant enzymes in relation to photosystem chlorophyll a fluorescence and photosynthetic pigment concentration for eight tropical tree species grown under 100% (sun) and 10% (shade) sunlight irradiation. The pioneer (early-succession) species (PS) were Cecropia pachystachya, Croton urucurana, Croton floribundus and Schinus terebinthifolius. The non-pioneer (late succession) species (LS) were Hymenaea courbaril L var. stilbocarpa, Esenbeckia leiocarpa, Cariniana legalis and Tabebuia roseo-alba. We observed a greater decline in the ratio of variable to maximum chlorophyll a fluorescence (F(v)/F(m)) under full sunlight irradiation in the late-successional species than in the pioneer species. The LS species most sensitive to high irradiance were C. legalis and H. courbaril. In LS species, chlorophyll a, chlorophyll b and total chlorophyll concentrations were higher in the shade-grown plants than in plants that developed under full sunlight, but in the PS species C. floribundus and C. pachystachya, we did not observe significant changes in chlorophyll content when grown in the two contrasting environments. The carotenoids/total chlorophyll ratio increased significantly when plants developed under high-sunlight irradiation, but this response was not observed in the PS species S. terebinthifolius and C. pachystachya. The improved performance of the pioneer species in high sunlight was accompanied by an increase in superoxide dismutase (SOD. EC 1.15.1.1) activity, though no light-dependent increase in the activity of ascorbate peroxidase (APX. EC 1.11.1.11) was observed. The activity of catalase (CAT, EC 1.11.1.6) was reduced by high irradiation in both pioneer and late-successional species. Our results show that pioneer species perform better under high-sunlight irradiation than late-successional species, as indicated by increased SOD activity and a higher F IF,, ratio. C. legalis was the LS species most susceptible to photoinhibition under full sunlight conditions. These results suggest that pioneer plants have more potential tolerance to photo-oxidative damage than late-successional species associated with the higher SOD activity found in pioneer species. Reduced photoinhibition in pioneer species probably results from their higher photosynthetic capacities, as has been observed in a previous survey carried out by our group. (C) 2010 Elsevier B.V. All rights reserved.
Resumo:
Eccentric exercise commonly results in muscle damage. The primary sequence of events leading to exercise-induced muscle damage is believed to involve initial mechanical disruption of sarcomeres, followed by impaired excitation-contraction coupling and calcium signaling, and finally, activation of calcium-sensitive degradation pathways. Muscle damage is characterized by ultrastructural changes to muscle architecture, increased muscle proteins and enzymes in the bloodstream, loss of muscular strength and range of motion and muscle soreness. The inflammatory response to exercise-induced muscle damage is characterized by leukocyte infiltration and production of pro-inflammatory cytokines within damaged muscle tissue, systemic release of leukocytes and cytokines, in addition to alterations in leukocyte receptor expression and functional activity. Current evidence suggests that inflammatory responses to muscle damage are dependent on the type of eccentric exercise, previous eccentric loading (repeated bouts), age and gender. Circulating neutrophil counts and systemic cytokine responses are greater after eccentric exercise using a large muscle mass (e.g. downhill running, eccentric cycling) than after other types of eccentric exercise involving a smaller muscle mass. After an initial bout of eccentric exercise, circulating leukocyte counts and cell surface receptor expression are attenuated. Leukocyte and cytokine responses to eccentric exercise are impaired in elderly individuals, while cellular infiltration into skeletal muscle is greater in human females than males after eccentric exercise. Whether alterations in intracellular calcium homeostasis influence inflammatory responses to muscle damage is uncertain. Furthermore, the effects of antioxidant supplements are variable, and the limited data available indicates that anti-inflammatory drugs largely have no influence on inflammatory responses to eccentric exercise. In this review, we compare local versus systemic inflammatory responses, and discuss some of the possible mechanisms regulating the inflammatory responses to exercise-induced muscle damage in humans.
Resumo:
PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
We investigated the effects of substance P (SP) and neurokinin A (NKA) infusion and acute stimulation of capsaicin-sensitive sensory nerves fibers (CAP) on lung recruitment of neuronal nitric oxide synthase (nNOS)-positive inflammatory and respiratory sepithelial (RE) cells in guinea-pigs. We evaluated if the effects of CAP stimulation were maintained until 14 days and had functional pulmonary repercussions. After 24 h of CAP and 30 min after SP and NKA infusions there was an increase in nNOS-positive eosinophils and mononuclear cells compared to controls (P < 0.05). SP group presented an increase in nNOS-positive RE (P < 0.05). After 14 days of CAP stimulation, there was a reduction in resistance (R-rs) and elastance (E-rs) of respiratory system in capsaicin pre-treated animals. We noticed a correlation between nNOS-positive eosinophils (R = -0.644, P < 0.05) and mononuclear cells (R = -0.88, P < 0.001) and R-rs. Concluding, CAP and neurokinins increase nNOS expression by inflammatory and RE cells. The increase in nNCS expression induced by low and high doses stimulation of CAP is longstanding and correlated to pulmonary mechanical repercussions. (c) 2007 Elsevier B.V. All rights reserved.
Resumo:
P>Background: Many patients with common variable immunodeficiency (CVID) have a clinical history suggestive of allergic respiratory disease. However, in such individuals, the prevalence of asthma and the role of atopy have not been well established. The objective of this study was to evaluate pulmonary function and identify asthma in patients with CVID. We also investigated the role of IgE as a trigger of asthma in these patients. Methods: Sixty-two patients diagnosed with CVID underwent spirometry, as well as skin prick testing and in vitro determination of serum-specific IgE levels for aeroallergens, together with bronchial provocation with histamine and allergen. Results: The most common alteration identified through spirometry was obstructive lung disease, which was observed in 29 (47.5%) of the 62 patients evaluated. Eighteen (29.0%) of the 62 patients had a clinical history suggestive of allergic asthma. By the end of the study, asthma had been diagnosed in nine (14.5%) patients and atopy had been identified in six (9.7%). In addition, allergic asthma had been diagnosed in four patients (6.5% of the sample as a whole; 22.2% of the 18 patients with a clinical history suggestive of the diagnosis). Conclusion: In this study, CVID patients testing negative for specific IgE antibodies and suspected of having allergic asthma presented a positive response to bronchial provocation tests with allergens. To our knowledge, this is the first such study. When CVID patients with a history suggestive of allergic asthma test negative on traditional tests, additional tests designed to identify allergic asthma might be conducted.
Resumo:
H-1 NMR spectra of the thyroid hormone thyroxine recorded at low temperature and high field show splitting into two peaks of the resonance due to the H2,6 protons of the inner (tyrosyl) ring. A single resonance is observed in 600 MHz spectra at temperatures above 185 K. An analysis of the line shape as a function of temperature shows that the coalescence phenomenon is due to an exchange process with a barrier of 37 kJ mol(-1). This is identical to the barrier for coalescence of the H2',6' protons of the outer (phenolic) ring reported previously for the thyroid hormones and their analogues. It is proposed that the separate peaks at low temperature are due to resonances for H2,6 in cisoid and transoid conformers which are populated in approximately equal populations. These two peaks are averaged resonances for the individual H2 and H6 protons. Conversion of cisoid to transoid forms can occur via rotation of either the alanyl side chain or the outer ring, from one face of the inner ring to the other. It is proposed that the latter process is the one responsible for the observed coalescence phenomenon. The barrier to rotation of the alanyl side chain is greater than or equal to 37 kJ mol(-1), which is significantly larger than has previously been reported for Csp(2)-Csp(3) bonds in other Ph-CH2-X systems. The recent crystal structure of a hormone agonist bound to the ligand-binding domain of the rat thyroid hormone receptor (Wagner et al. Nature 1995, 378, 690-697) shows the transoid form to be the bound conformation. The significant energy barrier to cisoid/transoid interconversion determined in the current study combined with the tight fit of the hormone to its receptor suggests that interconversion between the forms cannot occur at the receptor site but that selection for the preferred bound form occurs from the 50% population of the transoid form in solution.
Resumo:
We have developed a sensitive resonant four-wave mixing technique based on two-photon parametric four-wave mixing with the addition of a phase matched ''seeder'' field. Generation of the seeder field via the same four-wave mixing process in a high pressure cell enables automatic phase matching to be achieved in a low pressure sample cell. This arrangement facilitates sensitive detection of complex molecular spectra by simply tuning the pump laser. We demonstrate the technique with the detection of nitric oxide down to concentrations more than 4 orders of magnitude below the capability of parametric four-wave mixing alone, with an estimated detection threshold of 10(12) molecules/cm(3).
Resumo:
We aimed to investigate the vascular effects of hyperhomocysteinemia (HHcy) on carotid arteries from young and adult rats. With this purpose young and adult rats received a solution of DL-homocysteine-thiolactone (1 g/kg body weight/day) in the drinking water for 7, 14 and 28 days. Increase on plasma homocysteine occurred in young and adult rats treated with DL-homocysteine-thiolactone in all periods. Vascular reactivity experiments using standard muscle bath procedures showed that HHcy enhanced the contractile response of endothelium-intact, carotid rings to phenylephrine in both young and adult rats. However, in young rats, the increased phenylephrine-induced contraction was observed after hyperhomocysteinemia for 14 and 28 days, whereas in adult rats this response was already apparent after 7 day treatment. HHcy impaired acetylcholine-induced relaxation in arteries from adult but not young rats. The contraction induced by phenylephrine in carotid arteries in the presence of Y-27632 was reversed to control values in arteries from young but not adult rats with hyperhomocysteinemia. HHcy did not alter the contraction induced by CaCl(2) in carotid arteries from young rats, but enhanced CaCl(2)-induced contraction in the arteries from adult rats. HHcy increased the basal levels of superoxide anion in arteries from both groups. Finally, HHcy decreased the basal levels of nitrite in arteries from adult but not young rats. The major new finding of the present work is that arteries from young rats are more resistant to vascular changes evoked by HHcy than arteries from adult rats. Also, we verified that the enhanced vascular response to phenylephrine observed in carotid arteries of DL-homocysteine thiolactone-treated rats is mediated by different mechanisms in young and adult rats. (C) 2010 Published by Elsevier Inc.
Resumo:
Aims: To compare the performance of schizophrenia, mania and well control groups on tests sensitive to impaired executive ability, and to assess the within-group stability of these measures across the acute and subacute phases of psychoses. Method: Recently admitted patients with schizophrenia (n=36), mania (n=18) and a well control group (n=20) were assessed on two occasions separated by 4 weeks. Tests included: the Controlled Oral Word Association Test, the Stroop Test, the Wisconsin Card Sort Test, and the Trail Making Test. Results: The two patient groups were significantly impaired on the Stroop Test at both time points compared to the control group. Significant group differences were also found for the Trail Making Test at Time 1 and for the Wisconsin Card Sort Test at Time 2. When controlled for practice effect, significant improvements over time were found on the Stroop and Trail Making tests in the schizophrenia group and on WCST Categories Achieved in the mania group. Discussion: Compared to controls, the patient groups were impaired on measures related to executive ability. The pattern of improvement on test scores between the acute and subacute phases differed between patients with schizophrenia versus patients with mania. (C) 1997 Elsevier Science B.V.
Resumo:
Using the method of quantum trajectories we show that a known pure state can be optimally monitored through time when subject to a sequence of discrete measurements. By modifying the way that we extract information from the measurement apparatus we can minimize the average algorithmic information of the measurement record, without changing the unconditional evolution of the measured system. We define an optimal measurement scheme as one which has the lowest average algorithmic information allowed. We also show how it is possible to extract information about system operator averages from the measurement records and their probabilities. The optimal measurement scheme, in the limit of weak coupling, determines the statistics of the variance of the measured variable directly. We discuss the relevance of such measurements for recent experiments in quantum optics.
Resumo:
PURPOSE: To evaluate the impact of atypical retardation patterns (ARP) on detection of progressive retinal nerve fiber layer (RNFL) loss using scanning laser polarimetry with variable corneal compensation (VCC). DESIGN: Observational cohort study. METHODS: The study included 377 eyes of 221 patients with a median follow-up of 4.0 years. Images were obtained annually with the GDx VCC (Carl Zeiss Med, itec Inc, Dublin, California, USA), along with optic disc stereophotographs and standard automated perimetry (SAP) visual fields. Progression was determined by the Guided Progression Analysis software for SAP and by masked assessment of stereophotographs by expert graders. The typical scan score (TSS) was used to quantify the presence of ARPs on GDx VCC images. Random coefficients models were used to evaluate the relationship between ARP and RNFL thickness measurements over time. RESULTS: Thirty-eight eyes (10%) showed progression over time on visual fields, stereophotographs, or both. Changes in TSS scores from baseline were significantly associated with changes in RNFL thickness measurements in both progressing and nonprogressing eyes. Each I unit increase in TSS score was associated with a 0.19-mu m decrease in RNFL thickness measurement (P < .001) over time. CONCLUSIONS: ARPs had a significant effect on detection of progressive RNFL loss with the GDx VCC. Eyes with large amounts of atypical patterns, great fluctuations on these patterns over time, or both may show changes in measurements that can appear falsely as glaucomatous progression or can mask true changes in the RNFL. (Am J Ophthalmol 2009;148:155-163. (C) 2009 by Elsevier Inc. All rights reserved.)
Resumo:
Aim To compare the ability of scanning laser polarimeter (SLP) with variable corneal compensation (GDx VCC) and optical coherence tomograph (Stratus OCT) to discriminate between eyes with band atrophy (BA) of the optic nerve and healthy eyes. Methods The study included 37 eyes with BA and temporal visual field (VF) defects from chiasmal compression, and 29 normal eyes. Subjects underwent standard automated perimetry (SAP) and retinal nerve fibre layer (RNFL) scans using GDx VCC and Stratus OCT. The severity of the VF defects was evaluated by the temporal mean defect (TMD), calculated as the average of 22 values of the temporal total deviation plot on SAP. Receiver operating characteristic (ROC) curves were calculated. Pearson`s correlation coefficients were used to evaluate the relationship between RNFL thickness parameters and the TMD. Results No significant difference was found between the ROC curves areas (AUCs) for the GDx VCC and Stratus OCT with regard to average RNFL thickness (0.98 and 0.99, respectively) and the superior (0.94; 0.95), inferior (0.96; 0.97), and nasal (0.92; 0.96) quadrants. However, the AUC in the temporal quadrant (0.77) was significantly smaller (P < 0.001) with GDx VCC than with Stratus OCT (0.98). Lower TMD values were associated with smaller RNFL thickness in most parameters from both equipments. Conclusion Adding VCC resulted in improved performance in SLP when evaluating eyes with BA, and both technologies are sensitive in detecting average, superior, inferior, and nasal quadrant RNFL loss. However, GDx VCC still poorly discriminates RNFL loss in the temporal quadrant when compared with Stratus OCT.
Resumo:
Objectives: To analyze mortality rates of children with severe sepsis and septic shock in relation to time-sensitive fluid resuscitation and treatments received and to define barriers to the implementation of the American College of Critical Care Medicine/Pediatric Advanced Life Support guidelines in a pediatric intensive care unit in a developing country. Methods: Retrospective chart review and prospective analysis of septic shock treatment in a pediatric intensive care unit of a tertiary care teaching hospital. Ninety patients with severe sepsis or septic shock admitted between July 2002 and June 2003 were included in this study. Results: Of the 90 patients, 83% had septic shock and 17% had severe sepsis; 80 patients had preexisting severe chronic diseases. Patients with septic shock who received less than a 20-mL/kg dose of resuscitation fluid in the first hour of treatment had a mortality rate of 73%, whereas patients who received more than a 40-mL/kg dose in the first hour of treatment had a mortality rate of 33% (P < 0.05.) Patients treated less than 30 minutes after diagnosis of severe sepsis and septic shock had a significantly lower mortality rate (40%) than patients treated more than 60 Minutes after diagnosis (P < 0.05). Controlling for the risk of mortality, early fluid resuscitation was associated with a 3-fold reduction in the odds of death (odds ratio, 0.33; 95% confidence interval, 0.13-0.85). The most important barriers to achieve adequate severe sepsis and septic shock treatment were lack of adequate vascular access, lack of recognition of early shock, shortage of health care providers, and nonuse of goals and treatment protocols. Conclusions: The mortality rate was higher for children older than years, for those who received less than 40 mL/kg in the first hour, and for those whose treatment was not initiated in the first 30 Minutes after the diagnosis of septic shock. The acknowledgment of existing barriers to a timely fluid administration and the establishment of objectives to overcome these barriers may lead to a more successful implementation of the American College of Critical Care Medicine guidelines and reduced mortality rates for children with septic shock in the developing world.
Resumo:
Objective: Using longitudinal and prospective measures of trauma during childhood, the authors assessed the risk of developing psychotic symptoms associated with maltreatment, bullying, and accidents in a nationally representative U. K. cohort of young twins. Method: Data were from the Environmental Risk Longitudinal Twin Study, which follows 2,232 twin children and their families. Mothers were interviewed during home visits when children were ages 5, 7, 10, and 12 on whether the children had experienced maltreatment by an adult, bullying by peers, or involvement in an accident. At age 12, children were asked about bullying experiences and psychotic symptoms. Children`s reports of psychotic symptoms were verified by clinicians. Results: Children who experienced maltreatment by an adult (relative risk=3.16, 95% CI=1.92-5.19) or bullying by peers (relative risk=2.47, 95% CI=1.74-3.52) were more likely to report psychotic symptoms at age 12 than were children who did not experience such traumatic events. The higher risk for psychotic symptoms was observed whether these events occurred early in life or later in childhood. The risk associated with childhood trauma remained significant in analyses controlling for children`s gender, socioeconomic deprivation, and IQ; for children`s early symptoms of internalizing or externalizing problems; and for children`s genetic liability to developing psychosis. In contrast, the risk associated with accidents was small (relative risk=1.47, 95% CI=1.02-2.13) and inconsistent across ages. Conclusions: Trauma characterized by intention to harm is associated with children`s reports of psychotic symptoms. Clinicians working with children who report early symptoms of psychosis should inquire about traumatic events such as maltreatment and bullying.