Stable isotope, seismic sequence boundaries and bioevents in ODP Hole 166-1006A

During ODP Leg 166, the recovery of cores from a transect of drill sites across the Bahamas margin from marginal to deep basin environments was an essential requirement for the study of the response of the sedimentary systems to sea-level changes. A detailed biostratigraphy based on planktonic foraminifera was performed on ODP Hole 1006A for an accurate stratigraphic control. The investigated late middle Miocene-early Pliocene sequence spans the interval from about 12.5 Ma (Biozone N12) to approximately 4.5 Ma (Biozone N19). Several bioevents calibrated with the time scale of Berggren et al. (1995a,b) were identified. The ODP Site 1006 benthic oxygen isotope stratigraphy can be correlated to the corresponding deep-water benthic oxygen isotope curve from ODP Site 846 in the Eastern Equatorial Pacific (Shackleton et al., 1995. Proc. ODP Sci. Res. 138, 337-356), which was orbitally tuned for the entire Pliocene into the latest Miocene at 6.0 Ma. The approximate stratigraphic match of the isotopic signals from both records between 4.5 and 6.0 Ma implies that the paleoceanographic signal from the Bahamas is not simply a record of regional variations but, indeed, represents glacio-eustatic fluctuations. The ODP Site 1006 oxygen and carbon isotope record, based on benthic and planktonic foraminifera, was used to define paleoceanographic changes on the margin, which could be tied to lithostratigraphic events on the Bahamas carbonate platform using seismic sequence stratigraphy. The oxygen isotope values show a general cooling trend from the middle to late Miocene, which was interrupted by a significant trend towards warmer sea-surface temperatures (SST) and associated sea-level rise with decreased ice volume during the latest Miocene. This trend reached a maximum coincident with the Miocene/Pliocene boundary. An abrupt cooling in the early Pliocene then followed the warming which continued into the earliest Pliocene. The late Miocene paleoceanographic evolution along the Bahamas margin can be observed in the ODP Site 1006 delta13C values, which support other evidence for the beginning of the closure of the Panama gateway at 8 Ma followed by a reduced intermediate water supply of water from the Pacific into the Caribbean at about 5 Ma. A general correlation of lower sedimentation rates with the major seismic sequence boundaries (SSBs) was observed. Additionally, the SSBs are associated with transitions towards more positive oxygen isotope excursions. This observed correspondence implies that the presence of a SSB, representing a density impedance contrast in the sedimentary sequence, may reflect changes in the character of the deposited sediment during highstands versus those during lowstands. However, not all of the recorded oxygen isotope excursions correspond to SSBs. The absence of a SSB in association with an oxygen isotope excursion indicates that not all oxygen isotope sea-level events impact the carbonate margin to the same extent, or maybe even represent equivalent sea-level fluctuations. Thus, it can be tentatively concluded that SSBs produced on carbonate margins do record sea-level fluctuations but not every sea-level fluctuation is represented by a SSB in the sequence stratigraphic record.

Seismic Hazard and Ground Motion Characterization at the Itoiz Dam (Northern Spain).

This paper presents a new hazard-consistent ground motion characterization of the Itoiz dam site, located in Northern Spain. Firstly, we propose a methodology with different approximation levels to the expected ground motion at the dam site. Secondly, we apply this methodology taking into account the particular characteristics of the site and of the dam. Hazard calculations were performed following the Probabilistic Seismic Hazard Assessment method using a logic tree, which accounts for different seismic source zonings and different ground-motion attenuation relationships. The study was done in terms of peak ground acceleration and several spectral accelerations of periods coinciding with the fundamental vibration periods of the dam. In order to estimate these ground motions we consider two different dam conditions: when the dam is empty (T = 0.1 s) and when it is filled with water to its maximum capacity (T = 0.22 s). Additionally, seismic hazard analysis is done for two return periods: 975 years, related to the project earthquake, and 4,975 years, identified with an extreme event. Soil conditions were also taken into account at the site of the dam. Through the proposed methodology we deal with different forms of characterizing ground motion at the study site. In a first step, we obtain the uniform hazard response spectra for the two return periods. In a second step, a disaggregation analysis is done in order to obtain the controlling earthquakes that can affect the dam. Subsequently, we characterize the ground motion at the dam site in terms of specific response spectra for target motions defined by the expected values SA (T) of T = 0.1 and 0.22 s for the return periods of 975 and 4,975 years, respectively. Finally, synthetic acceleration time histories for earthquake events matching the controlling parameters are generated using the discrete wave-number method and subsequently analyzed. Because of the short relative distances between the controlling earthquakes and the dam site we considered finite sources in these computations. We conclude that directivity effects should be taken into account as an important variable in this kind of studies for ground motion characteristics.

An evaluation of seismic hazard in La Hispaniola, after the 2010 Haiti earthquake

An evaluation of the seismic hazard in La Hispaniola Island has been carried out, as part of the cooperative project SISMO-HAITI, supported by the Technical University of Madrid (UPM) and developed by several Spanish Universities, the National Observatory of Environment and Vulnerability) ONEV of Haiti, and with contributions from the Puerto Rico Seismic Network (PRSN) and University Seismological Institute of Dominican Republic (ISU). The study was aimed at obtaining results suitable for seismic design purposes. It started with the elaboration of a seismic catalogue for the Hispaniola Island, requiring an exhaustive revision of data reported by more than 20 seismic agencies, apart from these from the PRSN and ISU. The final catalogue contains 96 historical earthquakes and 1690 instrumental events, and it was homogenized to moment magnitude, Mw. Seismotectonic models proposed for the region were revised and a new regional zonation was proposed, taking into account geological andtectonic data, seismicity, focal mechanisms, and GPS observations. In parallel, attenuation models for subduction and crustal zones were revised in previous projects and the most suitable for the Caribbean plate were selected. Then, a seismic hazard analysis was developed in terms of peak ground acceleration, PGA, and spectral accelerations, SA (T), for periods of 0.1, 0.2, 0.5, 1 and 2s, using the Probabilistic Seismic Hazard Assessment (PSHA) methodology. As a result, different hazard maps were obtained for the quoted parameters, together with Uniform Hazard Spectra for Port au Prince and the main cities in the country. Hazard deaggregation was also carried out in these towns, for the target motion given by the PGA and SA (1s) obtained for return periods of 475, 975 and 2475 years. Therefore, the controlling earthquakes for short- and long-period target motions were derived. This study was started a few months after the 2010 earthquake, as a response to an aid request from the Haitian government to the UPM, and the results are available for the definition of the first building code in Haiti.

Seismic hazards of the Iberian Peninsula - evaluation with Kernel functions

The seismic hazard of the Iberian Peninsula is analysed using a nonparametric methodology based on statistical kernel functions; the activity rate is derived from the catalogue data, both its spatial dependence (without a seismogenetic zonation) and its magnitude dependence (without using Gutenberg–Richter's law). The catalogue is that of the Instituto Geográfico Nacional, supplemented with other catalogues around the periphery; the quantification of events has been homogenised and spatially or temporally interrelated events have been suppressed to assume a Poisson process. The activity rate is determined by the kernel function, the bandwidth and the effective periods. The resulting rate is compared with that produced using Gutenberg–Richter statistics and a zoned approach. Three attenuation laws have been employed, one for deep sources and two for shallower events, depending on whether their magnitude was above or below 5. The results are presented as seismic hazard maps for different spectral frequencies and for return periods of 475 and 2475 yr, which allows constructing uniform hazard spectra.

Uncertainty Analysis in New Seismic Hazard Study of Spain Aimed at the Revision of the Spanish Building Code.

In this paper we present a global overview of the recent study carried out in Spain for the new hazard map, which final goal is the revision of the Building Code in our country (NCSE-02). The study was carried our for a working group joining experts from The Instituto Geografico Nacional (IGN) and the Technical University of Madrid (UPM) , being the different phases of the work supervised by an expert Committee integrated by national experts from public institutions involved in subject of seismic hazard. The PSHA method (Probabilistic Seismic Hazard Assessment) has been followed, quantifying the epistemic uncertainties through a logic tree and the aleatory ones linked to variability of parameters by means of probability density functions and Monte Carlo simulations. In a first phase, the inputs have been prepared, which essentially are: 1) a project catalogue update and homogenization at Mw 2) proposal of zoning models and source characterization 3) calibration of Ground Motion Prediction Equations (GMPE’s) with actual data and development of a local model with data collected in Spain for Mw < 5.5. In a second phase, a sensitivity analysis of the different input options on hazard results has been carried out in order to have criteria for defining the branches of the logic tree and their weights. Finally, the hazard estimation was done with the logic tree shown in figure 1, including nodes for quantifying uncertainties corresponding to: 1) method for estimation of hazard (zoning and zoneless); 2) zoning models, 3) GMPE combinations used and 4) regression method for estimation of source parameters. In addition, the aleatory uncertainties corresponding to the magnitude of the events, recurrence parameters and maximum magnitude for each zone have been also considered including probability density functions and Monte Carlo simulations The main conclusions of the study are presented here, together with the obtained results in terms of PGA and other spectral accelerations SA (T) for return periods of 475, 975 and 2475 years. The map of the coefficient of variation (COV) are also represented to give an idea of the zones where the dispersion among results are the highest and the zones where the results are robust.

Seismic hazard of the Iberian Peninsula: evaluation with Kernel functions

The seismic hazard of the Iberian Peninsula is analysed using a nonparametric methodology based on statistical kernel functions; the activity rate is derived from the catalogue data, both its spatial dependence (without a seismogenic zonation) and its magnitude dependence (without using Gutenberg–Richter's relationship). The catalogue is that of the Instituto Geográfico Nacional, supplemented with other catalogues around the periphery; the quantification of events has been homogenised and spatially or temporally interrelated events have been suppressed to assume a Poisson process. The activity rate is determined by the kernel function, the bandwidth and the effective periods. The resulting rate is compared with that produced using Gutenberg–Richter statistics and a zoned approach. Three attenuation relationships have been employed, one for deep sources and two for shallower events, depending on whether their magnitude was above or below 5. The results are presented as seismic hazard maps for different spectral frequencies and for return periods of 475 and 2475 yr, which allows constructing uniform hazard spectra

(Table 1) Diatom events for AND1-1B, CIROS-2, DVDP-10, and DVDP-11 cores including observed and placed depths

Late Neogene stratigraphy of southern Victoria Land Basin is revealed in coastal and offshore drill cores and a network of seismic data in McMurdo Sound, Antarctica. These data preserve a record of ice sheet response to global climate variability and progressive cooling through the past 5 million years. Application of a composite standard age model for diatom event stratigraphy to the McMurdo Sound drill cores provides an internally precise mechanism to correlate stratigraphic data and derive an event history for the basin. These marine records are indirectly compared to data obtained from geological outcrop in the Transantarctic Mountains to produce an integrated history of Antarctic Ice Sheet response to climate variability from the early Pliocene to Recent. Four distinct chronostratigraphic intervals reflect stages and steps in a transition from a relatively warm early Pliocene Antarctic coastal climate to modern cold polar conditions. Several of these stages and steps correlate with global events identified via geochemical proxy data recovered from deep ocean cores in mid to low latitudes. These correlations allow us to consider linkages between the high southern latitudes and tropical regions and establish a temporal framework to examine leads and lags in the climate system through the late Neogene and Quaternary. The relative influence of climate-tectonic feedbacks is discussed in light of glacial erosion and isostatic rebound that also influence the history along the Southern Victoria Land coastal margin.

DOING MORE WITH SHORT PERIOD DATA: DETERMINING MAGNITUDES FROM CLIPPED AND OVER-RUN SEISMIC DATA AT MOUNT ST. HELENS

How can we calculate earthquake magnitudes when the signal is clipped and over-run? When a volcano is very active, the seismic record may saturate (i.e., the full amplitude of the signal is not recorded) or be over-run (i.e., the end of one event is covered by the start of a new event). The duration, and sometimes the amplitude, of an earthquake signal are necessary for determining event magnitudes; thus, it may be impossible to calculate earthquake magnitudes when a volcano is very active. This problem is most likely to occur at volcanoes with limited networks of short period seismometers. This study outlines two methods for calculating earthquake magnitudes when events are clipped and over-run. The first method entails modeling the shape of earthquake codas as a power law function and extrapolating duration from the decay of the function. The second method draws relations between clipped duration (i.e., the length of time a signal is clipped) and the full duration. These methods allow for magnitudes to be determined within 0.2 to 0.4 units of magnitude. This error is within the range of analyst hand-picks and is within the acceptable limits of uncertainty when quickly quantifying volcanic energy release during volcanic crises. Most importantly, these estimates can be made when data are clipped or over-run. These methods were developed with data from the initial stages of the 2004-2008 eruption at Mount St. Helens. Mount St. Helens is a well-studied volcano with many instruments placed at varying distances from the vent. This fact makes the 2004-2008 eruption a good place to calibrate and refine methodologies that can be applied to volcanoes with limited networks.

Evaluation of seismic losses of RC buildings: the case of the industrial areas after the 2012 Emilia Earthquake

The topic of seismic loss assessment not only incorporates many aspects of the earthquake engineering, but also entails social factors, public policies and business interests. Because of its multidisciplinary character, this process may be complex to challenge, and sound discouraging to neophytes. In this context, there is an increasing need of deriving simplified methodologies to streamline the process and provide tools for decision-makers and practitioners. This dissertation investigates different possible applications both in the area of modelling of seismic losses, both in the analysis of observational seismic data. Regarding the first topic, the PRESSAFE-disp method is proposed for the fast evaluation of the fragility curves of precast reinforced-concrete (RC) structures. Hence, a direct application of the method to the productive area of San Felice is studied to assess the number of collapses under a specific seismic scenario. In particular, with reference to the 2012 events, two large-scale stochastic models are outlined. The outcomes of the framework are promising, in good agreement with the observed damage scenario. Furthermore, a simplified displacement-based methodology is outlined to estimate different loss performance metrics for the decision-making phase of the seismic retrofit of a single RC building. The aim is to evaluate the seismic performance of different retrofit options, for a comparative analysis of their effectiveness and the convenience. Finally, a contribution to the analysis of the observational data is presented in the last part of the dissertation. A specific database of losses of precast RC buildings damaged by the 2012 Earthquake is created. A statistical analysis is performed, allowing deriving several consequence functions. The outcomes presented may be implemented in probabilistic seismic risk assessments to forecast the losses at the large scale. Furthermore, these may be adopted to establish retrofit policies to prevent and reduce the consequences of future earthquakes in industrial areas.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

High-energy events and short-term changes in superficial beach sediments

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Surveillance for adverse events after DTwP/Hib vaccination in Brazil: sensitivity and factors associated with reporting

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use