965 resultados para Rosary, Our Lady of the.


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Inscription: Verso: The Woman's Salon, New York. Robin Morgan reading "Lady of the Beasts" (left). At right is writer Erika Duncan, one of the founders of the Women's Salon.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Since the sequencing of the human genome was completed, attention has turned to examining the functionality of the molecular machinery, in particular of protein expression. Differential proteome analysis by two-dimensional electrophoresis has been adopted to study changes in T cell proteomes during T cell activation, and this work is increasing our understanding of the complexity of signals elicited across multiple pathways. The purpose of this review is to summarize the available evidence in the application of proteomic techniques and methodologies to understand T cell receptor activation from lipid raft and cytoskeletal rearrangements, through to signalling cascades, transcription factor modulation and changes in protein expression patterns. These include post-translational modifications, which are not encoded by the genome. © 2007 British Society for Immunology.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The recent interferometric study of Achernar, leading to the conclusion that its geometrical oblateness cannot be explained by the Roche approximation, has stirred substantial interest in the community, in view of its potential impact on many fields of stellar astrophysics. It is the purpose of this Letter to reinterpret the interferometric observations with a fast-rotating, gravity-darkened central star surrounded by a small equatorial disk, whose presence is consistent with contemporaneous spectroscopic data. We find that we can fit the available data only assuming a critically rotating central star. We identified two different disk models that simultaneously fit the spectroscopic, polarimetric, and interferometric observational constraints: a tenuous disk in hydrostatic equilibrium (i.e., with small scale height) and a smaller, scale height enhanced disk. We believe that these relatively small disks correspond to the transition region between the photosphere and the circumstellar environment and that they are probably perturbed by some photospheric mechanism. The study of this interface between photosphere and circumstellar disk for near-critical rotators is crucial to our understanding of the Be phenomenon and the mass and angular momentum loss of stars in general. This work shows that it is nowadays possible to directly study this transition region from simultaneous multitechnique observations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Context. HD 181231 is a B5IVe star, which has been observed with the CoRoT satellite during similar to 5 consecutive months and simultaneously from the ground in spectroscopy and spectropolarimetry. Aims. By analysing these data, we aim to detect and characterize as many pulsation frequencies as possible, to search for the presence of beating effects possibly at the origin of the Be phenomenon. Our results will also provide a basis for seismic modelling. Methods. The fundamental parameters of the star are determined from spectral fitting and from the study of the circumstellar emission. The CoRoT photometric data and ground-based spectroscopy are analysed using several Fourier techniques: CLEAN-NG, PASPER, and TISAFT, as well as a time-frequency technique. A search for a magnetic field is performed by applying the LSD technique to the spectropolarimetric data. Results. We find that HD 181231 is a B5IVe star seen with an inclination of similar to 45 degrees. No magnetic field is detected in its photosphere. We detect at least 10 independent significant frequencies of variations among the 54 detected frequencies, interpreted in terms of non-radial pulsation modes and rotation. Two longer-term variations are also detected: one at similar to 14 days resulting from a beating effect between the two main frequencies of short-term variations, the other at similar to 116 days due either to a beating of frequencies or to a zonal pulsation mode. Conclusions. Our analysis of the CoRoT light curve and ground-based spectroscopic data of HD 181231 has led to the determination of the fundamental and pulsational parameters of the star, including beating effects. This will allow a precise seismic modelling of this star.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Context. The cosmic time around the z similar to 1 redshift range appears crucial in the cluster and galaxy evolution, since it is probably the epoch of the first mature galaxy clusters. Our knowledge of the properties of the galaxy populations in these clusters is limited because only a handful of z similar to 1 clusters are presently known. Aims. In this framework, we report the discovery of a z similar to 0.87 cluster and study its properties at various wavelengths. Methods. We gathered X-ray and optical data (imaging and spectroscopy), and near and far infrared data (imaging) in order to confirm the cluster nature of our candidate, to determine its dynamical state, and to give insight on its galaxy population evolution. Results. Our candidate structure appears to be a massive z similar to 0.87 dynamically young cluster with an atypically high X-ray temperature as compared to its X-ray luminosity. It exhibits a significant percentage (similar to 90%) of galaxies that are also detected in the 24 mu m band. Conclusions. The cluster RXJ1257.2+4738 appears to be still in the process of collapsing. Its relatively high temperature is probably the consequence of significant energy input into the intracluster medium besides the regular gravitational infall contribution. A significant part of its galaxies are red objects that are probably dusty with on-going star formation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: Life cycles of medusozoan cnidarians vary widely, and have been difficult to document, especially in the most recently proposed class Staurozoa. However, molecular data can be a useful tool to elucidate medusozoan life cycles by tying together different life history stages. Methodology/Principal Findings: Genetic data from fast-evolving molecular markers (mitochondrial 16S, nuclear ITS1, and nuclear ITS2) show that animals that were presumed to be a hydrozoan, Microhydrula limopsicola (Limnomedusae, Microhydrulidae), are actually an early stage of the life cycle of the staurozoan Haliclystus antarcticus (Stauromedusae, Lucernariidae). Conclusions/Significance: Similarity between the haplotypes of three markers of Microhydrula limopsicola and Haliclystus antarcticus settles the identity of these taxa, expanding our understanding of the staurozoan life cycle, which was thought to be more straightforward and simple. A synthetic discussion of prior observations makes sense of the morphological, histological and behavioral similarities/congruence between Microhydrula and Haliclystus. The consequences are likely to be replicated in other medusozoan groups. For instance we hypothesize that other species of Microhydrulidae are likely to represent life stages of other species of Staurozoa.45

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Moniliophthora perniciosa is a hemibiotrophic fungus that causes witches` broom disease (WBD) in cacao. Marked dimorphism characterizes this fungus, showing a monokaryotic or biotrophic phase that causes disease symptoms and a later dikaryotic or saprotrophic phase. A combined strategy of DNA microarray, expressed sequence tag, and real-time reverse-transcriptase polymerase chain reaction analyses was employed to analyze differences between these two fungal stages in vitro. In all, 1,131 putative genes were hybridized with cDNA from different phases, resulting in 189 differentially expressed genes, and 4,595 reads were clusterized, producing 1,534 unigenes. The analysis of these genes, which represent approximately 21% of the total genes, indicates that the biotrophic-like phase undergoes carbon and nitrogen catabollite repression that correlates to the expression of phytopathogenicity genes. Moreover, downregulation of mitochondrial oxidative phosphorylation and the presence of a putative ngr1 of Saccharomyces cerevisiae could help explain its lower growth rate. In contrast, the saprotrophic mycelium expresses genes related to the metabolism of hexoses, ammonia, and oxidative phosphorylation, which could explain its faster growth. Antifungal toxins were upregulated and could prevent the colonization by competing fungi. This work significantly contributes to our understanding of the molecular mechanisms of WBD and, to our knowledge, is the first to analyze differential gene expression of the different phases of a hemibiotrophic fungus.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We report first-principles density-functional calculations for hydroquinone (HQ), indolequinone (IQ), and semiquinone (SQ). These molecules are believed to be the basic building blocks of the eumelanins, a class of biomacromolecules with important biological functions (including photoprotection) and with the potential for certain bioengineering applications. We have used the difference of self-consistent fields method to study the energy gap between the highest occupied molecular orbital and the lowest unoccupied molecular orbital, HL. We show that HL is similar in IQ and SQ, but approximately twice as large in HQ. This may have important implications for our understanding of the observed broadband optical absorption of the eumelanins. The possibility of using this difference in HL to molecularly engineer the electronic properties of eumelanins is discussed. We calculate the infrared and Raman spectra of the three redox forms from first principles. Each of the molecules have significantly different infrared and Raman signatures, and so these spectra could be used in situ to nondestructively identify the monomeric content of macromolecules. It is hoped that this may be a helpful analytical tool in determining the structure of eumelanin macromolecules and hence in helping to determine the structure-property-function relationships that control the behavior of the eumelanins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The secreted phospholipases A(2) (sPLA(2)s) are water-soluble enzymes that bind to the surface of both artificial and biological lipid bilayers and hydrolyze the membrane phospholipids. The tissue expression pattern of the human group IID secretory phospholipase A(2) (hsPLA(2)-IID) suggests that the enzyme is involved in the regulation of the immune and inflammatory responses. With an aim to establish an expression system for the hsPLA(2)-IID in Escherichia coli, the DNA-coding sequence for hsPLA(2)-IID was subcloned into the vector pET3a, and expressed as inclusion bodies in E. coli (BL21). A protocol has been developed to refold the recombinant protein in the presence of guanidinium hydrochloride, using a size-exclusion chromatography matrix followed by dilution and dialysis to remove the excess denaturant. After purification by cation-exchange chromatography, far ultraviolet circular dichroism spectra of the recombinant hsPLA(2)-IID indicated protein secondary structure content similar to the homologous human group IIA secretory phospholipase A(2). The refolded recombinant hsPLA(2)-IID demonstrated Ca(2+)-dependent hydrolytic activity, as measuring the release free fatty acid from phospholipid liposomes. This protein expression and purification system may be useful for site-directed mutagenesis experiments of the hsPLA(2)-IID which will advance our understanding of the structure-function relationship and biological effects of the protein. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The E7 transforming protein of Human Papillomavirus type 16 (HPV16) is expressed in the skin of a line of RIB mice transgenic for the E6 and E7 open reading frames of HPV16 driven from the alpha A crystallin promoter (FVB alpha AcryHPV16E6E7). We have transferred skin from FVB alpha AcryHPV16E6E7 mice to naive or E7-primed syngeneic NE recipients to assess whether the E7 protein of HPV16 can function as a minor transplantation antigen (MTA) and promote skin graft rejection. FVB mice did not reject E7 expressing tail or flank skin grafts. E7 immunized FVB x C57BL/6J mice recipients of FVB alpha AcryHPV16E6E7 x C57BL/6J skin generated humoral and DTH responses to E7 in vivo and E7-specific CTL precursors in the spleen, but failed to reject 57 expressing tail skin grafts by 100 days posttransfer. Thus although HPV16 E7 + ve mesenchymal and endodermal tumors can be eliminated by an E7-specific immune response, the same protein is unable to act as a MTA and promote graft rejection when expressed in skin cells. Lack of rejection of grafts expressing MTAs such as E7 may be relevant to the immunology of epithelial tumors expressing tumor-specific antigens and to our understanding of the immunology of diseases of the skin. (C) 1997 Academic Press.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Development of a self-report measure of stress specific to HIV/AIDS is needed to advance our understanding of the role of stress in adaptation to HIV/AIDS: hence, the aim of this study was the development of the HIV/AIDS Stress Scale. A total of 132 homosexual/bisexual men with HIV/AIDS v ere interviewed and completed the HIV/AIDS Stress Scale and measures of coping strategies, appraisal, social support and adjustment (global distress, depression, social adjustment, number of HIV symptoms, and subjective health status) at three time points. Thirty-nine primary caregivers were interviewed and completed measures of stress and adjustment. Exploratory factor analyses of the HIV/AIDS Stress Scale items revealed three factors: Social, Instrumental and Emotional/Existential Stress. Factors had adequate internal reliabilities and were stable over 12 months. Construct validation data are consistent with recent stress/coping research that links higher levels of stress with more HIV symptoms. reliance on emotion-focused coping, lower social support, poorer levels of adjustment and higher levels of caregiver stress. Results extend this research by revealing new differential relations between various stress dimensions and stress/coping variables. Convergent validation data suggest that the HIV/AIDS Stress Scale shares conceptual similarity with threat appraisal. and differs from control liability and challenge appraisals. The HIV/AIDS Stress Scale shows potential for the elucidation of the role of stress in coping and adaptation to HIV/AIDS and disease progression in both research and clinical applications.