Produção de biomassa e eficiência no uso da água para oito variedades de cana-de-açúcar irrigadas por gotejamento em dois ciclos de cultivo

A irrigação quando bem manejada, pode minimizar os riscos econômicos da atividade sucroalcooleira, particularmente em safras com presença de instabilidade climática onde a restrição hídrica, promovida pela diminuição no volume de chuvas, pode reduzir a produtividade dos canaviais. Dentre as ferramentas disponíveis para a gestão eficiente da água na agricultura irrigada, a técnica de irrigação sob déficit pode se tornar uma escolha acertada para a cana-de-açúcar, desde que sejam identificadas as fases fenológicas e épocas de cultivo onde a limitação da oferta de água não implique em reduções antieconômicas no rendimento da cultura. Diante disso, a hipótese que norteia essa pesquisa, é a de que existe uma estratégia de irrigação sob déficit, que associada a uma variedade com características específicas, possibilite a expressão de indicadores de produtividade tão satisfatórios quanto os obtidos em condições de irrigação plena. Nessa linha, os objetivos da pesquisa envolveram o estudo da dinâmica foliar, acúmulo e particionamento de biomassa e ainda, índices de produtividade da água para biomassa, açúcar e etanol de 1ª e 2ª geração de oito variedade de cana-de-açúcar, submetidas a diferentes condições de disponibilidade hídrica no solo em dois ciclos de cultivo (cana-planta e cana-soca). A pesquisa foi realizada na Escola Superior de Agricultura \"Luiz de Queiroz\", em Piracicaba/SP, onde foram estudados os dois primeiros ciclos de cultivo da cana-de-açúcar, sendo estes abordados nesta tese como Experimento 1 (cana-planta) e Experimento 2 (cana-soca). O delineamento experimental adotado para ambos os ciclos foi o de blocos casualizados, com três blocos completos. Os tratamentos foram compostos por três fatores em esquema de parcelas sub-subdivididas. Estas parcelas foram formadas por duas plantas (touceiras) alocadas em um vaso com aproximadamente 330 litros de solo. No Experimento 1, foram estudados três fatores, sendo o primeiro e segundo com quatro níveis e o terceiro com oito (4x4x8), totalizando assim 128 tratamentos, sendo eles: quatro níveis de irrigação ao longo do ciclo (125, 100, 75 e 50% da ETc); oito variedades comerciais de cana-de-açúcar e quatro procedimentos de maturação, impostos por meio de variações na intensidade do déficit hídrico aplicado. Para o Experimento 2, substitui-se o fator Maturação por Épocas de Corte, o qual consistiu em colheitas de um quarto do experimento a cada 90 dias. Os resultados encontrados apontaram que a área foliar responde positivamente a maior disponibilidade hídrica no solo, tendo sido verificado uma relação proporcional entre estes. Quanto ao acúmulo de biomassa, verificou-se que para as oito variedades estudadas houve incremento de biomassa a medida em que se aumentou o volume de água disponibilizado às variedades. No tocante ao particionamento, as folhas foram os drenos principais de fotoassimilados da planta até os 100 dias de cultivo, sendo que após este período, os colmos ocuparam o lugar de dreno preferencial. Os indicadores de produtividade da água apresentaram diferenças significativas para o fator lâmina, o que indica a existência de cultivares de cana-de-açúcar mais eficientes no uso da água. Por fim, observou-se que a produtividade da água para etanol total apresentou valores expressivos, com média para essa variável igual a 1,81 L m-3, o que denota o potencial de rendimento de etanol (1G + 2G) a partir da cana-de-açúcar quando é adotado o aproveitamento integral das plantas.

Polarimetric SAR model for soil moisture estimation over vineyards at C-band

In this paper we propose a two-component polarimetric model for soil moisture estimation on vineyards suited for C-band radar data. According to a polarimetric analysis carried out here, this scenario is made up of one dominant direct return from the soil and a multiple scattering component accounting for disturbing and nonmodeled signal fluctuations from soil and short vegetation. We propose a combined X-Bragg/Fresnel approach to characterize the polarized direct response from soil. A validation of this polarimetric model has been performed in terms of its consistency with respect to the available data both from RADARSAT-2 and from indoor measurements. High inversion rates are reported for different phenological stages of vines, and the model gives a consistent interpretation of the data as long as the volume component power remains about or below 50% of the surface contribution power. However, the scarcity of soil moisture measurements in this study prevents the validation of the algorithm in terms of the accuracy of soil moisture retrieval and an extensive campaign is required to fully demonstrate the validity of the model. Different sources of mismatches between the model and the data have been also discussed and analyzed.

Polarimetric Response of Rice Fields at C-Band: Analysis and Phenology Retrieval

A set of ten RADARSAT-2 images acquired in fully polarimetric mode over a test site with rice fields in Seville, Spain, has been analyzed to extract the main features of the C-band radar backscatter as a function of rice phenology. After observing the evolutions versus phenology of different polarimetric observables and explaining their behavior in terms of scattering mechanisms present in the scene, a simple retrieval approach has been proposed. This algorithm is based on three polarimetric observables and provides estimates from a set of four relevant intervals of phenological stages. The validation against ground data, carried out at parcel level for a set of six stands and up to nine dates per stand, provides a 96% rate of coincidence. Moreover, an equivalent compact-pol retrieval algorithm has been also proposed and validated, providing the same performance at parcel level. In all cases, the inversion is carried out by exploiting a single satellite acquisition, without any other auxiliary information.

Dynamical Approach for Real-Time Monitoring of Agricultural Crops

In this paper, a novel approach for exploiting multitemporal remote sensing data focused on real-time monitoring of agricultural crops is presented. The methodology is defined in a dynamical system context using state-space techniques, which enables the possibility of merging past temporal information with an update for each new acquisition. The dynamic system context allows us to exploit classical tools in this domain to perform the estimation of relevant variables. A general methodology is proposed, and a particular instance is defined in this study based on polarimetric radar data to track the phenological stages of a set of crops. A model generation from empirical data through principal component analysis is presented, and an extended Kalman filter is adapted to perform phenological stage estimation. Results employing quad-pol Radarsat-2 data over three different cereals are analyzed. The potential of this methodology to retrieve vegetation variables in real time is shown.

Effets de l’environnement lumineux et de l’âge foliaire sur la croissance, la capacité photosynthétique et la production protéique chez "Nicotiana benthamiana"

Cette étude visait à caractériser la croissance, la capacité photosynthétique, la concentration en azote et protéines totales solubles, la production de protéines recombinantes (HA) ainsi que la quantité de lumière interceptée à différents stades de développement de plants de Nicotiana benthamiana afin d’optimiser la production de vaccins. L’évolution des réponses physiologiques étudiées fut similaire chez toutes les feuilles primaires, suggérant que le processus de sénescence s’initie et progresse de façon semblable indépendamment de leur ordre d’initiation. Toutefois, la superposition des patrons temporels de sénescence et de croissance foliaire a mené à un rendement HA maximal se situant invariablement dans la partie médiane du plant lorsqu’exprimé sur une base foliaire. À l’échelle du plant entier, nos résultats suggèrent qu’il est possible d’augmenter la production de vaccins en récoltant les plants à un stade de développement plus tardif, ou en augmentant la densité de culture et en récoltant ces plants plus tôt.

Assessing canopy temperature patterns in two grapevine varieties subjected to deficit irrigation: a tool to optimize water management ?

A better understanding of grapevine responses to drought and high air temperatures can help to optimize vineyard management to improve water use efficiency, yield and berry quality. Faster and robust field phenotyping tools are needed in modern precision viticulture, in particular in dry and hot regions such as the Mediterranean. Canopy temperature (Tc) is commonly used to monitor water stress in plants/crops and to characterize stomatal physiology in different woody species including Vitis vinifera. Thermography permits remote determination of leaf surface or canopy temperature in the field and also to assess the range and spatial distribution of temperature from different parts of the canopies. Our hypothesis is that grapevine genotypes may show different Tc patterns along the day due to different stomatal behaviour and heat dissipation strategies. We have monitored the diurnal and seasonal course of Tc in two grapevine genotypes, Aragonez (syn. Tempranillo) and Touriga Nacional subjected to deficit irrigation under typical Mediterranean climate conditions. Temperature measurements were complemented by determination of the diurnal course of leaf water potential (ψleaf) and leaf gas exchange. Measurements were done in two seasons (2013 and 2014) at different phenological stages: i) mid-June (green berry stage), ii) mid-July (veraison), iii) early August (early ripening) and iv) before harvest (late ripening). Correlations between Tc and minimal stomatal conductance will be presented for the two genotypes along the day. Results are discussed over the use of thermal imagery to derive information on genotype physiology in response to changing environmental conditions and to mild water stress induced by deficit irrigation. Strategies to optimize the use of thermal imaging in field conditions are also proposed

Calibration of Grassmaster II to estimate green and dry matter yield in Mediterranean pastures: effects of pasture moisture content

Accurate assessment of standing pasture biomass in livestock production systems is a major factor for improving feed planning. Several tools are available to achieve this, including the GrassMaster II capacitance meter. This tool relies on an electrical signal, which is modified by the surrounding pasture. There is limited knowledge on how this capacitance meter performs in Mediterranean pastures. Therefore, we evaluated the GrassMaster II under Mediterranean conditions to determine (i) the effect of pasture moisture content (PMC) on the meter’s ability to estimate pasture green matter (GM) and dry matter (DM) yields, and (ii) the spatial variability and temporal stability of corrected meter readings (CMR) and DM in a bio-diverse pasture. Field tests were carried out with typical pastures of the southern region of Portugal (grasses, legumes, mixture and volunteer annual species) and at different phenological stages (and different PMC). There were significant positive linear relations between CMR and GM (r2 = 0.60, P < 0.01) and CMR and DM (r2 = 0.35, P < 0.05) for all locations (n = 347). Weak relationships were found for PMC (%) v. slope and coefficient of determination for both GM and DM. A significant linear relation existed for CMR v. GM and DM for PMC >80% (r2= 0.57, P < 0.01, RMSE = 2856.7 kg ha–1, CVRMSE=17.1% to GM; and r2= 0.51, P < 0.01,RMSE = 353.7 kg ha–1, CVRMSE = 14.3% to DM). Therefore, under the conditions of this current study there exists an optimum PMC (%) for estimating both GM and DM with the GrassMaster II. Repeated-measurements taken at the same location on different dates and conditions in a bio-diverse pasture showed similar and stable patterns between CMR and DM (r2= 0.67, P < 0.01, RMSE = 136.1 kg ha–1, CVRMSE = 6.5%). The results indicate that the GrassMaster II in-situ technique could play a crucial role in assessing pasture mass to improve feed planning under Mediterranean conditions.

Influence of Two Acyclic Homoterpenes (Tetranorterpenes) on the foraging behavior of Anthonomus grandis Boh.

2016

Influence of soybean phenological stage and leaflets age on infection by Phakopsora pachyrhizi

Influence of soybean phenological stage and leaflets age on infection by Phakopsora pachyrhizi This work was conducted to study the influence of soybean growth stage and leaf age on the infection of Phakopsora pachyrhizi, the soybean rust pathogen. Soybean plants (cv. BRS 154 and BRS 258) at the V(3), R(1) and R(5) growth stages were inoculated with a 1 x 10(5) urediniospores per mL suspension. After a period of 24 hours in dew chambers, all plants were removed from the chambers and placed under greenhouse conditions for 20 days. Mean latent period (PLM) and disease severity were estimated. The susceptibility of trifoliate leaves to soybean rust was estimated on cv. BRS 154 at the growth stage R5. Pathogen inoculation was done at the first four trifoliate leaves. Fifteen days after inoculation, leaflets of each trefoil were evaluated for disease severity, lesion mean size and infection frequency. Plants` growth stage did not influence the PLM. Cultivars BRS 154 and BRS 258 presented PLM of 8 and 9 days, respectively. There was no difference in disease severity at the growth stages V(3) and R(1), but those values were higher than at the R(5) growth stage, 8 days after inoculation. The oldest trefoil showed the highest disease values.

Effects of light and temperature on isoprene emission at different leaf developmental stages of eschweilera coriacea in central Amazon

Isoprene emission from plants accounts for about one third of annual global volatile organic compound emissions. The largest source of isoprene for the global atmosphere is the Amazon Basin. This study aimed to identify and quantify the isoprene emission and photosynthesis at different levels of light intensity and leaf temperature, in three phenological phases (young mature leaf, old mature leaf and senescent leaf) of Eschweilera coriacea (Matamatá verdadeira), the species with the widest distribution in the central Amazon. In situ photosynthesis and isoprene emission measurements showed that young mature leaf had the highest rates at all light intensities and leaf temperatures. Additionally, it was observed that isoprene emission capacity (Es) changed considerably over different leaf ages. This suggests that aging leads to a reduction of both leaf photosynthetic activity and isoprene production and emission. The algorithm of Guenther et al. (1999) provided good fits to the data when incident light was varied, however differences among E S of all leaf ages influenced on quantic yield predicted by model. When leaf temperature was varied, algorithm prediction was not satisfactory for temperature higher than ~40 °C; this could be because our data did not show isoprene temperature optimum up to 45 °C. Our results are consistent with the hypothesis of the isoprene functional role in protecting plants from high temperatures and highlight the need to include leaf phenology effects in isoprene emission models.

Flooded rice yield as affected by levels of water salinity in different stages of its cycle

Losses of productivity of flooded rice in the State of Rio Grande do Sul, Brazil, may occur in the Coastal Plains and in the Southern region due to the use of saline water from coastal rivers, ponds and the Laguna dos Patos lagoon, and the sensibility of the plants are variable according to its stage of development. The purpose of this research was to evaluate the production of rice grains and its components, spikelet sterility and the phenological development of rice at different levels of salinity in different periods of its cycle. The experiment was conducted in a greenhouse, in pots filled with 11 dm³ of an Albaqualf. The levels of salinity were 0.3 (control), 0.75, 1.5, 3.0 and 4.5 dS m-1 kept in the water layer by adding a salt solution of sodium chloride, except for the control, in different periods of rice development: tillering initiation to panicle initiation; tillering initiation to full flowering; tillering initiation to physiological maturity; panicle initiation to full flowering; panicle initiation to physiological maturity and full flowering to physiological maturity. The number of panicles per pot, the number of spikelets per panicle, the 1,000-kernel weight, the spikelet sterility, the grain yield and phenology were evaluated. All characteristics were negatively affected, in a quadratic manner, with increased salinity in all periods of rice development. Among the yield components evaluated, the one most closely related to grain yields of rice was the spikelet sterility.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Isoprenoid biosynthesis in the erythrocytic stages of Plasmodium falciparum

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

Factors associated with stages of change for red meat and vegetable intake by Japanese-Brazilians

Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.