963 resultados para METAL-COMPLEX
Resumo:
A multinary molecular nanocluster, in which a T3 supertetrahedral [Sn4Ga4Zn2Se20](8-) core was neutralized and covalently terminated by four [(TEPA)Mn](2+) (TEPA = tetraethylenepentamine) metal complexes, was synthesized and characterized. The cluster is assembled into, through hydrogen bonding and van de Waals forces, a superlattice that is chemically stable and free of strong covalent coupling. The four different cations were distributed within the cluster in such a manner that both the local charge balance and global charge compensation by the metal complex could be satisfied.
Resumo:
Two novel organic-inorganic hybrid compounds, (H(2)enMe)(4)(H3O)[Ni(enMe)(2)].[Na3Mo12O52P8(OH)(10)].5H(2)O (1) and (H(2)enMe)(4)(H3O)[Cu(enMe)(2)].[Na3Mo12O52P8(OH)(10)].5H(2)O (2) (enMe = 1,2-diaminopropane), have been hydrothermally synthesized and characterized by elemental analyses, IR, EPR, XPS, UV-Vis spectra and TG analyses. Single crystal X-ray diffraction shows that 1 and 2 are isostructural compounds. Both the compounds exhibit an unusual two-dimensional (2-D) window-like network consisting of one-dimensional (1-D) chains of sodium molybdenum phosphate anions connected by transition metal coordination complexes cations. Compound 1 and 2 represent the first 2-D molybdenum phosphate skeleton pillared by transition metal complex fragments.
Resumo:
A novel 4-aminobenzoic acid (4-ABA) monolayer film is formed on glassy carbon electrode (GCE) by amino cation radical method. Silicotungstic heteropolyanion (SiW12O404-, denoted as SiW12)-containing multilayer films have been fabricated on the 4-ABA modified GCE surface by alternate deposition with a quaternized poly(4-vinylpyridine) partially complexed with [Os(bpy)(2)Cl](2+/+) (denoted as QPVP-Os). Cyclic voltammetry (CV), X-ray photoelectron spectroscopy (XPS) and X-ray reflectivity (XR) have been used to characterise the as-prepared multilayer films. It is proved that the multilayer films are uniform and stable. The average thickness for a bilayer of QPVP-Os/SiW12 in the multilayer film is 30.2 Angstrom. The electrocatalytic activities of the multilayer films have been investigated on the reduction of three substrates of important analytical interests, HNO2, BrO3- and H2O2. Especially, the influence of layer number of the multilayer films on the electrocatalytic reduction of HNO2 has been investigated in detail. (C) 2000 Elsevier Science B.V. All rights reserved.
Resumo:
The research work in this thesis reports rapid separation of biologically important low molecular weight compounds by microchip electrophoresis and ultrahigh liquid chromatography. Chapter 1 introduces the theory and principles behind capillary electrophoresis separation. An overview of the history, different modes and detection techniques coupled to CE is provided. The advantages of microchip electrophoresis are highlighted. Some aspects of metal complex analysis by capillary electrophoresis are described. Finally, the theory and different modes of the liquid chromatography technology are presented. Chapter 2 outlines the development of a method for the capillary electrophoresis of (R, S) Naproxen. Variable parameters of the separation were optimized (i.e. buffer concentration and pH, concentration of chiral selector additives, applied voltage and injection condition).The method was validated in terms of linearity, precision, and LOD. The optimized method was then transferred to a microchip electrophoresis system. Two different types of injection i.e. gated and pinched, were investigated. This microchip method represents the fastest reported chiral separation of Naproxen to date. Chapter 3 reports ultra-fast separation of aromatic amino acid by capillary electrophoresis using the short-end technique. Variable parameters of the separation were optimized and validated. The optimized method was then transferred to a microchip electrophoresis system where the separation time was further reduced. Chapter 4 outlines the use of microchip electrophoresis as an efficient tool for analysis of aluminium complexes. A 2.5 cm channel with linear imaging UV detection was used to separate and detect aluminium-dopamine complex and free dopamine. For the first time, a baseline, separation of aluminium dopamine was achieved on a 15 seconds timescale. Chapter 5 investigates a rapid, ultra-sensitive and highly efficient method for quantification of histamine in human psoriatic plaques using microdialysis and ultrahigh performance liquid chromatography with fluorescence detection. The method utilized a sub-two-micron packed C18 stationary phase. A fluorescent reagent, 4-(1-pyrene) butyric acid N-hydroxysuccinimide ester was conjugated to the primary and secondary amino moieties of histamine. The dipyrene-labeled histamine in human urine was also investigated by ultrahigh pressure liquid chromatography using a C18 column with 1.8 μm particle diameter. These methods represent one of the fastest reported separations to date of histamine using fluorescence detection.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The adsorption of cadmium(II) on freshly precipitated aluminium(III) hydroxide in the presence of a range of chelates has been investigated. By precipitating the metal, chelate and adsorbent together it is possible to change the pH variation of the metal-complex adsorption from anionic, ligand-like, binding to cationic binding. This is a general phenomenon and is explained by the formation of a ternary Al-O-Cd-L surface species. As a consequence of the preparation method, the pH edge is found to shift to lower pH values in the presence of the chelate which gives rise to an apparent increase in adsorption of Cd2+. This increase is, in general, most pronounced at [chelate] / [metal] > 1. Computer modelling shows that the observed trends result from the competition between Al-O-Cd-L and Al-L for the available aluminium( III) binding sites. The enhanced adsorption in the presence of phenylenediaminetetraacetate is anomalous since it is observed at a [ chelate] / [metal] approximate to 0.1 and cannot be interpreted by the simple competition model.
Resumo:
N-Alkyl-N-methylpyrrolidinium cations have been used for the design of ionic liquid crystals, including a new type of uranium-containing metallomesogen. Pyrrolidinium salts with bromide, bis(trifluoromethylsulfonyl)-imide, tetrafluoroborate, hexafluorophosphate, thiocyanate, tetrakis(2-thenoyltrifluoroacetonato)europate(III) and tetrabromouranyl] counteranions were prepared. For the bromide salts and tetrabromouranyl compounds, the chain length of the alkyl group CnH2n+1 was varied from eight to twenty carbon atoms (n =8. 10-20). The compounds show rich mesomorphic behaviour: highly ordered smectic phases (the crystal smectic E phase and the uncommon crystal smectic T phase), smectic A phases, and hexagonal. columnar phases were observed, depending on chain length and anion. This work gives better insight into the nature and formation of the crystal smectic T phase, and the Molecular requirements for the appearance of this highly ordered phase. This uncommon tetragonal mesophase is thoroughly discussed on the basis of detailed powder X-ray diffraction experiments and in relation to the existing literature. Structural models are proposed for self-assembly of the molecules within the smectic layers. In addition, the photophysical properties of the compounds containing a metal complex anion were investigated. For the uranium-containing mesogens, luminescence can be induced by dissolving them in an ionic: liquid matrix. The europium-containing compound shows intense red photoluminescence with high colour Purity.
Resumo:
Disguising a metal complex as a micelle by using amphiphilic phosphine ligands enables it to switch between a coordination polymer and a discrete cage in response to solvent polarity or pH; this medium-dependent behaviour of the complex is rational because it parallels that of true micelles.
Resumo:
Scission of a supramolecular polymer-metal complex can be carried out using collapsing cavitation bubbles created by ultrasound. Although the most plausible scission mechanism of the coordinative bonds is through mechanical force, the influence of radicals and high hot-spot temperatures on scission has to be considered. A silver(I)-N-heterocyclic carbene complex was exposed to 20 kHz ultrasound in argon, nitrogen, methane, and isobutane saturated toluene. Scission percentages were almost equal under argon, nitrogen, and methane. Radical production differs by a factor of 10 under these gases, indicating that radical production is not a significant contributor to the scission process. A model to describe the displacement of the bubble wall, strain rates, and temperature in the gas shows that critical strain rates for coil-to-stretch transition, needed for scission, are achieved at reactor temperatures of 298 K, an acoustic pressure of 1.2 x 10(5) Pa, and an acoustic frequency of 20 kHz. Lower scission percentages were measured under isobutane, which also shows lower strain rates in model simulations. The activation of the polymer-metal complexes in toluene under the influence of ultrasound occurs through mechanical force.
Resumo:
No presente trabalho, foi avaliado o desempenho e a aplicabilidade do eléctrodo de filme fino de mercúrio, em estudos de especiação dinâmica de metais vestigiais. Para tal, foram utilizadas duas técnicas electroanalíticas de redissolução: a clássica Voltametria de Redissolução Anódica (ASV) e a recentemente desenvolvida, Cronopotenciometria de Redissolução com varrimento do potencial de deposição (SSCP). As propriedades de troca-iónica e de transporte de massa de películas mistas preparadas a partir de dois polímeros com características distintas, o Nafion (NA) e o 4-Poliestireno sulfonato de sódio (PSS), foram avaliadas, antes da sua aplicação no âmbito da especiação de metais. Estas películas de NA-PSS demonstraram uma elevada sensibilidade, reprodutibilidade, estabilidade mecânica, bem como, propriedades de anti-bloqueio adequadas na modificação química do eléctrodo de filme fino de mercúrio (TMFE) e, na sua aplicação na determinação de catiões metálicos vestigiais em amostras complexas, por ASV. Para além disso, o desempenho de membranas do polielectrólito PSS em estudos de voltametria de troca-iónica (IEV) foi estudado. O objectivo desta investigação foi reunir as condições ideais na preparação de películas de PSS estáveis e com uma densidade de carga negativa elevada, de modo a aumentar a acumulação electrostática de catiões metálicos no filme polimérico e por conseguinte, conseguir incrementos no sinal voltamétrico. O desempenho e aplicabilidade do TMFE em estudos de especiação de metais vestigiais foram extendidos à SSCP como técnica analítica. Dada a elevada sensibilidade e resolução evidenciada pelo TMFE, este revelou ser uma alternativa adequada aos eléctrodos de mercúrio convencionais, podendo ser utilizado durante um dia de trabalho, sem degradação aparente do sinal analítico de SCP. As curvas de SSCP obtidas experimentalmente utilizando o TMFE estavam em concordância com aquelas previstas pela teoria. Para além disso, a constante de estabilidade (K) calculada a partir do desvio do potencial de meia-onda, para dois sistemas metal-complexo lábeis, aproxima-se não só do valor teórico, como também daquele obtido utilizando o eléctrodo de mercúrio de gota suspensa (HMDE). Adicionalmente, o critério experimental de labilidade inerente a esta técnica foi validado e o grau de labilidade para um dado sistema metal-complexo foi determinado, utilizando o filme fino de mercúrio depositado sob um eléctrodo rotativo (TMF-RDE). Este eléctrodo é muito útil na determinação de parâmetros cinéticos, como é o caso da constante de velocidade de associação (ka), uma vez que as condições hidrodinâmicas, durante a etapa de deposição, se encontram bem definidas.
Resumo:
Two efficient, regio- and stereo controlled synthetic approaches to the synthesis of racemic analogs of pancratistatin have been accomplished and they serve as the model systems for the total synthesis of optically active 7-deoxy-pancratistatin. In the Diels-Alder approach, an efficient [4+2] cycloaddition of 3,4-methylenedioxyco- nitrostyrene with Danishefsky's diene to selectively form an exo-nitro adduct has been developed as the key step in the construction of the C-ring of the target molecule. In the Michael addition approach, the key step was a conjugate addition of an organic zinc-cuprate to the 3,4-methylenedioxy-(B-nitrostyrene, followed by a diastereocontroUed closure to form the cyclohexane C-ring of the target molecule via an intramolecular nitro-aldol cyclization on a neutral alumina surface. A chair-like transition state for such a cyclization has been established and such a chelation controlled transition state can be useful in the prediction of diastereoselectivity in other related 6-exo-trig nitroaldol reactions. Cyclization of the above products fi^om both approaches by using a Bischler-Napieralski type reaction afforded two lycoricidine derivatives 38 and 50 in good yields. The initial results from the above modeling studies as well as the analysis of the synthetic strategy were directed to a chiral pool approach to the total synthesis of optically active 7-deoxy-pancratistatin. Selective monsilylation and iodination of Ltartaric acid provided a chiral precursor for the proposed key Michael transformation. The outlook for the total synthesis of 7-deoxy-pancratistatin by this approach is very promising.A concise synthesis of novel designed, optically pure, Cz-symmetrical disulfonylamide chiral ligands starting from L-tartaric acid has also been achieved. This sequence employs the metallation of indole followed by Sfj2 replacement of a dimesylate as the key step. The activity for this Cz-symmetric chiral disulfonamide ligand in the catalytic enantioselective reaction has been confirmed by nucleophilic addition to benzaldehyde in the disulfonamide-Ti (0-i-Pr)4-diethylzinc system with a 48% yield and a 33% e.e. value. Such a ligand tethered with a suitable metal complex should be also applicable towards the total synthesis of 7-deoxy-pancratistatin.
Resumo:
The crystal structure of Cu(PM)2(N03hoH20 (where PM is pyridoxamine, CSHI2N202) has been determined from three dimensional x-ray diffraction data. The crystals are triclinic, space group pI, a = 14.248 (2), b = 8.568 (1), c = 9.319 (1) 1, a = 94.08 (1), e = 89.73 (1), y~~ 99.18 (1)°, z = 2, jl(MoK) = 10.90 em-I, Po = 1.61 g/cm3 and Pc = 1.61 g/em3• The structure a was solved by Patterson techniques from data collected on a Picker 4-circle diffractometer to 26max = 45°. All atoms, including hydrogens, have been located. Anisotropic thermal parameters have been refined for all nonhydrogen atoms. For the 2390 independent reflections with F ? 3cr(F) , R = 0.0408. The results presented here provide the first detailed structural information of a metal complex with PM itself. The copper atoms are located on centres of symmetry and each is chela ted by two PM zwitterions through the amino groups and phenolate oxygen atoms. The zwitterionic form found in this structure involves the loss of a proton from the phenolate group and protonation of the pyridine ring nitrogen atoms. The two independent Cu(PM)2 moieties are symmetrically bridged by a single oxygen atom from one of the nitrate groups. The second nitrate group is not coordinated to the copper atoms but is central to an extensive hydrogen bonding network involving the water molecule and uncoordinated functional groups of PM.
Resumo:
Résumé: Dans le but de préparer des complexes de Zr pour la catalyse homogène de la polymérisation des lactides et de l’hydroamination des olefines, l’elaboration et l’optimisation d’une méthode systématique et efficace de synthèse des ligands dikétimines ayant différents substituants alkyles (R) à la position N,N’ a été realisée. Des dikétimines (nacnacRH) symétriques ont été obtenus avec une pureté de plus de 95 % et un rendement de 65 % lorsque R = Me et des rendements allant de 80 à 95 % lorsque le groupe R = n-Pr, i-Pr, i-Bu, Bu, Cy et (+)-CH(Me)Ph. La synthèse des dikétimines ayant des substituants N-alkyls différents, dite asymétriques, donne toujours un mélange statistique de trois ligands: nacnacR,R’H, nacnacR,RH et nacnacR’,R’H qui n’ont pu être separés. Seuls les dikétimines asymétriques avec un substituant N-alkyl et un autre N-aryl (nacnacR,ArH) ont été obtenus avec des rendements plus élevés que celui du mélange statistique. Par la suite, la complexation de ces ligands bidentés au Zr, la caractérisation de ces complexes et l’investigation de la réactivité ont été étudiés. Les complexes de Zr de type (nacnacR)2ZrCl2 ont été obtenus par deux voies de synthèse principales: la première consiste à traiter le sel de lithium du ligand avec le ZrCl4. La seconde est la réaction du ligand avec les complexes neutres d’alkyl-zirconium(IV) par protonation de l'alkyle coordonné. En solution, les complexes obtenus de (nacnacR)2ZrX2 possèdent un comportement dynamique via un « Bailar-twist » et les paramètres d'activation de cette isomérisation ont été calculés. Le complexe octaèdrique (nacnacBn)2ZrCl2 n'est pas réactif dans la carbozirconation et son alkylation n'était pas possible par l’échange des chlorures avec les alkyles. L’analogue diméthylé (nacnacBn)2ZrMe2 peut être préparé par alkylation du ZrCl4 avant la complexation du ligand. On a également observé que ce dernier n’est pas réactif dans la carbozirconation. L‘analogue diéthoxyde (nacnacBn)2Zr(OEt)2 est obtenu par échange des diméthyles avec les éthoxydes. La polymérisation du lactide avec celui-ci en tant que précurseur est relativement lente et ne peut être effectuée que dans le monomère fondu. Par conséquent, pour résoudre les problèmes rencontrés avec les complexes de zirconium (dikétiminates non-pontés), un ligand dikétimines pontés par le diaminocyclohexane, (±)-C6H10(nacnacXylH)2, LH2, (Xyl = 2,6-diméthylphényle) a été préparé. La complexation de ce ligand tetradenté au metal a été réalisée par deux voies de synthèse; la première est la réaction du sel de lithium de ce ligand avec le ZrCl4(THF)2. La deuxième est la déprotonation du ligand neutre avec le Zr(NMe2)4 et l’élimination du diméthylamine. Des complexes du type: (±)-C6H10(nacnacXylH)2ZrX2 avec X = Cl, NMe2 ont été obtenus. Les ligands de chlorure sont dans ce cas facilement remplaçables par des éthoxydes ou des méthyles. On a observé l’activité la plus élevée jamais observée pour un complexe d’un métal du groupe 4 avec le complexe de (±)-C6H10(nacnacXylH)2Zr(OEt)2 dans la polymérisation de lactide. L'étude cinétique a montré que la loi de vitesse est du premier ordre en catalyseur et en monomère et la constante de vitesse est k = 14 (1) L mol-1 s-1. L'analyse des polymères a montré l’obtention de masses moléculaires faibles et l’abscence de stéréocontrôle. La réaction de (±)-C6H10(nacnacXylH)2ZrCl2 avec le triflate d’argent donne le (±)-C6H10(nacnacXylH)2Zr(OTf)2. Le complexe bis-triflate obtenu possède une activité catalytique elevée pour les additions du type aza-Michael. L’utilisation du R,R-C6H10(nacnacXylH)2Zr(OTf)2 énantiopur comme catalyseur, dans les additions du type aza-Michael asymétriques donne le produit desiré avec un excès énantiomérique de 19%.
Resumo:
The metal complex, [Ni(en)2(H2O)2](NO3)2 (en = ethylenediamine), was decomposed in a static furnace at 200 C by autogenous decomposition to obtain phase pure metallic nickel nanocrystallites. The nickel metal thus obtained was studied by XRD, IR spectra, SEM and CHN analysis. The nickel crystallites are in the nanometer range as indicated by XRD studies. The IR spectral studies and CHN analyses show that the surface is covered with a nitrogen containing species. Thermogravimetric mass gain shows that the product purity is high (93%). The formed nickel is stable and resistant to oxidation up to 350 C probably due to the coverage of nitrogen containing species. Activation energy for the oxidation of the prepared nickel nanocrystallites was determined by non-isothermal methods and was found to depend on the conversion ratio. The oxidation kinetics of the nickel crystallites obeyed a Johnson–Mehl–Avrami mechanism probably due to the special morphology and crystallite strain present on the metal.
Resumo:
Photochromic nitrospiropyrans substituted with 2,2'-bipyridine (bpy), [Ru(bpy)(3)](2+), and [Os(bpy)(3)](2+) groups were synthesized, and their photophysical, photochemical, and redox properties investigated. Substitution of the spiropyran with the metal complex moiety results in strongly decreased efficiency of the ring-opening process as a result of energy transfer from the excited spiropyran to the metal center. The lowest excited triplet state of the spiropyran in its open merocyanine form is lower in energy than the excited triplet MLCT level of the [Ru(bpy)(3)](2+) moiety but higher in energy than for [Os(bpy)(3)](2+), resulting in energy transfer from the excited ruthenium center to the spiropyran but inversely in the osmium case. The open merocyanine form reduces and oxidizes electrochemically more easily than the closed nitrospiropyran. Like photoexcitation, electrochemical activation also causes opening of the spiropyran ring by first reducing the closed form and subsequently reoxidizing the corresponding radical anion in two well-resolved anodic steps. Interestingly, the substitution of the spiropyran with a Ru or Os metal center does not affect the efficiency of this electrochemically induced ring-opening process, different from the photochemical path.