936 resultados para Intermediate Stages


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fate of key species, such as the barnacle Amphibalanus improvisus, in the course of global change is of particular interest since any change in their abundance and/or performance may entail community-wide effects. In the fluctuating Western Baltic, species typically experience a broad range of environmental conditions, which may preselect them to better cope with climate change. In this study, we examined the sensitivity of two crucial ontogenetic phases (naupliar, cypris) of the barnacle toward a range of temperature (12, 20, and 28°C) and salinity (5, 15, and 30 psu) combinations. Under all salinity treatments, nauplii developed faster at intermediate and high temperatures. Cyprid metamorphosis success, in contrast, was interactively impacted by temperature and salinity. Survival of nauplii decreased with increasing salinity under all temperature treatments. Highest settlement rates occurred at the intermediate temperature and salinity combination, i.e., 20°C and 15 psu. Settlement success of "naive" cyprids, i.e., when nauplii were raised in the absence of stress (20°C/15 psu), was less impacted by stressful temperature/salinity combinations than that of cyprids with a stress history. Here, settlement success was highest at 30 psu particularly at low and high temperatures. Surprisingly, larval survival was not highest under the conditions typical for the Kiel Fjord at the season of peak settlement (20°C/15 psu). The proportion of nauplii that ultimately transformed to attached juveniles was, however, highest under these "home" conditions. Overall, only particularly stressful combinations of temperature and salinity substantially reduced larval performance and development. Given more time for adaptation, the relatively smooth climate shifts predicted will probably not dramatically affect this species.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Our understanding of early spatial vision owes much to contrast masking and summation paradigms. In particular, the deep region of facilitation at low mask contrasts is thought to indicate a rapidly accelerating contrast transducer (eg a square-law or greater). In experiment 1, we tapped an early stage of this process by measuring monocular and binocular thresholds for patches of 1 cycle deg-1 sine-wave grating. Threshold ratios were around 1.7, implying a nearly linear transducer with an exponent around 1.3. With this form of transducer, two previous models (Legge, 1984 Vision Research 24 385 - 394; Meese et al, 2004 Perception 33 Supplement, 41) failed to fit the monocular, binocular, and dichoptic masking functions measured in experiment 2. However, a new model with two-stages of divisive gain control fits the data very well. Stage 1 incorporates nearly linear monocular transducers (to account for the high level of binocular summation and slight dichoptic facilitation), and monocular and interocular suppression (to fit the profound 42 Oral presentations: Spatial vision Thursday dichoptic masking). Stage 2 incorporates steeply accelerating transduction (to fit the deep regions of monocular and binocular facilitation), and binocular summation and suppression (to fit the monocular and binocular masking). With all model parameters fixed from the discrimination thresholds, we examined the slopes of the psychometric functions. The monocular and binocular slopes were steep (Weibull ߘ3-4) at very low mask contrasts and shallow (ߘ1.2) at all higher contrasts, as predicted by all three models. The dichoptic slopes were steep (ߘ3-4) at very low contrasts, and very steep (ß>5.5) at high contrasts (confirming Meese et al, loco cit.). A crucial new result was that intermediate dichoptic mask contrasts produced shallow slopes (ߘ2). Only the two-stage model predicted the observed pattern of slope variation, so providing good empirical support for a two-stage process of binocular contrast transduction. [Supported by EPSRC GR/S74515/01]

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The thermo-chemical conversion of green microalgae Chlamydomonas reinhardtii wild type (CCAP 11/32C), its cell wall deficient mutant C. reinhardtii CW15 (CCAP 11/32CW15) and Chlorella vulgaris (CCAP 211/11B) as well as their proteins and lipids was studied under conditions of intermediate pyrolysis. The microalgae were characterised for ultimate and gross chemical composition, lipid composition and extracted products were analysed by Thermogravimetric analysis (TG/DTG) and Pyrolysis-gaschromatography/mass-spectrometry (Py-GC/MS). Proteins accounted for almost 50% and lipids 16-22 % of dry weight of cells with little difference in the lipid compositions between the C. reinhardtii wild type and the cell wall mutant. During TGA analysis, each biomass exhibited three stages of decomposition, namely dehydration, devolatilization and decomposition of carbonaceous solids. Py-GC/MS analysis revealed significant protein derived compounds from all algae including toluene, phenol, 4-methylphenol, 1H-indole, 1H-indole-3methyl. Lipid pyrolysis products derived from C. reinhardtii wild type and C. reinhardtii CW15 were almost identical and reflected the close similarity of the fatty acid profiles of both strains. Major products identified were phytol and phytol derivatives formed from the terpenoid chain of chlorophyll, benzoic acid alkyl ester derivative, benzenedicarboxylic acid alkyl ester derivative and squalene. In addition, octadecanoic acid octyl ester, hexadecanoic acid methyl ester and hydrocarbons including heptadecane, 1-nonadecene and heneicosane were detected from C. vulgaris pyrolysed lipids. These results contrast sharply with the types of pyrolytic products obtained from terrestrial lignocellulosic feedstocks and reveal that intermediate pyrolysis of algal biomass generates a range of useful products with wide ranging applications including bio fuels.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundamental analytical pyrolysis studies of biomass from Polar seaweeds, which exhibit a different biomass composition than terrestrial and micro-algae biomass were performed via thermogravimetric analysis (TGA) and pyrolysis-gas chromatography/mass-spectrometry (Py-GC/MS). The main reason for this study is the adaptation of these species to very harsh environments making them an interesting source for thermo-chemical processing for bioenergy generation and production of biochemicals via intermediate pyrolysis. Several macroalgal species from the Arctic region Kongsfjorden, Spitsbergen/Norway (Prasiola crispa, Monostroma arcticum, Polysiphonia arctica, Devaleraea ramentacea, Odonthalia dentata, Phycodrys rubens, Sphacelaria plumosa) and from the Antarctic peninsula, Potter Cove King George Island (Gigartina skottsbergii, Plocamium cartilagineum, Myriogramme manginii, Hymencladiopsis crustigena, Kallymenia antarctica) were investigated under intermediate pyrolysis conditions. TGA of the Polar seaweeds revealed three stages of degradation representing dehydration, devolatilization and decomposition of carbonaceous solids. The maximum degradation temperatures Prasiola crispa were observed within the range of 220-320 C and are lower than typically obtained by terrestrial biomass, due to divergent polysaccharide compositions. Biochar residues accounted for 33-46% and ash contents of 27-45% were obtained. Identification of volatile products by Py-GC/MS revealed a complexity of generated chemical compounds and significant differences between the species. A widespread occurrence of aromatics (toluene, styrene, phenol and 4-methylphenol), acids (acetic acid, benzoic acid alkyl ester derivatives, 2-propenoic acid esters and octadecanoic acid octyl esters) in pyrolysates was detected. Ubiquitous furan-derived products included furfural and 5-methyl-2-furaldehyde. As a pyran-derived compound maltol was obtained by one red algal species (P. rubens) and the monosaccharide d-allose was detected in pyrolysates in one green algal (P. crispa). Further unique chemicals detected were dianhydromannitol from brown algae and isosorbide from green algae biomass. In contrast, the anhydrosugar levoglucosan and the triterpene squalene was detected in a large number of pyrolysates analysed. © 2013 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Nitrogen requirements at bulb initiation for production of intermediate-day onions Article in Acta horticulturae · October 2016 DOI: 10.17660/ActaHortic.2016.1142.11 1st Rui Machado 16.44 · Universidade de Évora 2nd David R. Bryla 30.16 · United States Department of Agriculture Abstract Nitrogen requirements at bulb initiation for production of intermediate-day onions Authors: R.M.A. Machado, D.R. Bryla Keywords: Allium cepa, crop growth, nitrogen uptake, soil nitrate Abstract: The effect of nitrogen application on growth, nitrogen (N) uptake, yield, and quality of intermediate-day onion (Allium cepa 'Guimar') was evaluated in the field in southern Portugal. Plants were fertilized with 30 kg ha-1 N at transplanting, 10 kg ha-1 N at 29 days after transplanting (DAT) during early leaf growth, and with 0, 20, 40 and 60 kg ha-1 N at 51 DAT at the initiation of bulbing. The root system of plants in each treatment were concentrated in the top 0.1 m of soil and limited to 0.3 m depth but neither root length density nor rooting depth were affected by N application during later stages of bulb development. Leaf and bulb dry matter, on the other hand, increased linearly with N rate during bulb growth (85 DAT) and at harvest (114 DAT), respectively. Soil nitrate-N (NO3-N) at 0-0.3 m depth likewise increased linearly with N rate during bulb growth but declined from 15-30 mg kg-1 at bulbing to >10 mg kg-1 in each treatment by harvest. A substantial amount of N in the plants, which ranged from 302-525 mg, was taken up from the soil. Application of 60 kg ha-1 N resulted in luxury consumption. Yield (fresh bulb weight) increased from 0.19 kg plant-1 with no N at bulbing to as much as 0.28 kg plant-1 with 60 kg ha-1 N. Bulbs harvested from plants fertilized 40-60 kg ha-1 N averaged 8.2-8.5 cm in diameter, while those from plants with no N at bulbing averaged only 7.2 cm in diameter. Application of N fertilizer is thus recommended at bulbing to increase N uptake, yield, and bulb size of intermediate-day onions, particularly in dry Mediterranean climates where many onions are produced. Other components of quality, including neck diameter, bulb water content, total soluble solids, and juice pH, were not affect by N applied at bulbing.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Os estádios de desenvolvimento dos ovários da lagosta Panulirus echinatus Smith, 1869 foram caracterizados com base nos aspectos macroscópicos, microscópicos e na relação gonadossomática (RGS). Através de amostragem mensal (novembro/1999 a outubro/2000) foram capturadas 711 fêmeas, empregando-se redes de espera de fundo. Retirou-se a região dorsal da carapaça para avaliação dos ovários. Estes foram dissecados, pesados, fixados em solução de Bouin e submetidos aos procedimentos histológicos. A análise microscópica dos ovários foi avaliada pela presença de células germinativas nas diferentes fases de desenvolvimento. Esta análise quando associada a macroscopia (mudança de cor e volume das gônadas no cefalotórax) e a relação gonadossomática (RGS) possibilitou a caracterização de cinco estádios de desenvolvimento: imaturo (I), em desenvolvimento (II), pré-maturação (III), maduro (IV) e pós-desova (V). As análises estatísticas confirmaram que a RGS pode ser utilizada como indicadora dos estádios de maturidade.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Esta pesquisa caracteriza os estádios de desenvolvimento dos testículos e canais deferentes da lagosta Panulirus echinatus Smith, 1869 a partir da relação entre seus aspectos macroscópicos, microscópicos e a relação gonadossomática (RGS). Através de amostragem mensal (novembro de 1999 a outubro de 2000) foram capturados 1716 machos, empregando-se redes de espera de fundo. Retirou-se a região dorsal da carapaça para avaliação dos órgãos reprodutivos. Os testículos e canais deferentes foram dissecados, pesados, fixados em solução de Bouin e submetidos aos procedimentos histológicos. A análise microscópica dos órgãos reprodutivos foi avaliada pela presença ou ausência de espermatozóides nos testículos e canais deferentes. Esta, quando associada a macroscopia (mudança de cor, tamanho, diâmetro e desenvolvimento de espermatóforo) e a relação gonadossomática (RGS), possibilitou a caracterização de três estádios de desenvolvimento: imaturo, intermediário e maturo. Ficou evidenciada que a maturidade dos testículos precedeu a maturidade dos canais deferentes. Para avaliar se a RGS é um bom indicador quantitativo dos estádios de maturidade, um teste t (alfa = 0,05) foi usado e constatou diferença significativa nas médias da RGS. A RGS pode ser utilizada como indicadora dos estádios de maturidade para P. echinatus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present K-band spectra of the near infrared counterparts to IRS 2E and IRS 2W which is associated with the ultracompact H II region W51d, both of them embedded sources in the Galactic compact H II region W51 IRS 2. The high spatial resolution observations were obtained with the laser guide star facility and Near-infrared Integral Field Spectrograph (NIFS) mounted at the Gemini-North observatory. The spectrum of the ionizing source of W51d shows the photospheric features N III ( 21155 angstrom) in emission and He II ( 21897 angstrom) in absorption which lead us to classify it as a young O3 type star. We detected CO overtone in emission at 23000 angstrom in the spectrum of IRS 2E, suggesting that it is a massive young object still surrounded by an accretion disk, probably transitioning from the hot core phase to an ultracompact H II region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. The formation of ultra-compact dwarf galaxies (UCDs) is believed to be driven by interaction, and UCDs are abundant in the cores of galaxy clusters, environments that mark the end-point of galaxy evolution. Nothing is known about the properties of UCDs in compact groups of galaxies, environments where most of galaxy evolution and interaction is believed to occur and where UCDs in an intermediate stage in their evolution may be expected. Aims. The main goal of this study is to detect and characterize, for the first time, the UCD population of compact groups of galaxies. For that, two nearby groups in different evolutionary stages, HCG22 and HCG90, were targeted. Methods. We selected about 40 UCD candidates from pre-existing photometry of both groups, and obtained spectra of these candidates using the VLT FORS2 instrument in MXU mode. Archival HST/ACS imaging was used to measure their structural parameters. Results. We detect 16 and 5 objects belonging to HCG22 and HCG90, respectively, covering the magnitude range -10.0 > M(R) > -11.5 mag. Their integrated colours are consistent with old ages covering a broad range in metallicities (metallicities confirmed by the spectroscopic measurements). Photometric mass estimates put 4 objects in HCG90 and 9 in HCG22 in the mass range of UCDs (> 2 x 10(6) M(circle dot)) for an assumed age of 12Gyr. These UCDs are on average 2-3 times larger than the typical size of Galactic GCs, covering a range of 2 less than or similar to r(h) less than or similar to 21 pc. The UCDs in HCG22 are more concentrated around the central galaxy than in HCG90, at the 99% confidence level. They cover a broad range in [alpha/Fe] abundances from sub-to super-solar. The spectra of 3 UCDs (2 in HCG22, 1 in HCG90) show tentative evidence of intermediate age stellar populations. The clearest example is the largest and most massive UCD (similar to 10(7) M(circle dot)) in our sample, which is detected in HCG22. Its properties are most consistent with a stripped dwarf galaxy nucleus. We calculate the specific frequency (S(N)) of UCDs for both groups, finding that HCG22 has about three times higher S(N) than HCG90. Conclusions. The ensemble properties of the detected UCDs supports two co-existing formation channels: a star cluster origin (low-luminosity, compact sizes, old ages, super-solar alpha/Fe), and an origin as tidally stripped dwarf nuclei (more extended and younger stellar populations). Our results imply that the UCDs detected in both groups do not, in their majority, originate from relatively recent galaxy interactions. Most of the detected UCDs have likely been brought into the group along with their host galaxies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. Compact groups of galaxies are entities that have high densities of galaxies and serve as laboratories to study galaxy interactions, intergalactic star formation and galaxy evolution. Aims. The main goal of this study is to search for young objects in the intragroup medium of seven compact groups of galaxies: HCG 2, 7, 22, 23, 92, 100 and NGC 92 as well as to evaluate the stage of interaction of each group. Methods. We used Fabry-Perot velocity fields and rotation curves together with GALEX NUV and FUV images and optical R-band and HI maps. Results. (i) HCG 7 and HCG 23 are in early stages of interaction; (ii) HCG 2 and HCG 22 are mildly interacting; and (iii) HCG 92, HCG 100 and NGC 92 are in late stages of evolution. We find that all three evolved groups contain populations of young blue objects in the intragroup medium, consistent with ages < 100 Myr, of which several are younger than < 10 Myr. We also report the discovery of a tidal dwarf galaxy candidate in the tail of NGC 92. These three groups, besides containing galaxies that have peculiar velocity fields, also show extended HI tails. Conclusions. Our results indicate that the advanced stage of evolution of a group, together with the presence of intragroup HI clouds, may lead to star formation in the intragroup medium. A table containing all intergalactic HII regions and tidal dwarf galaxies confirmed to date is appended.