206 resultados para Individualization


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Imatinib (Glivec®) has transformed the treatment and short-term prognosis of chronic myeloid leukemia (CML) and gastrointestinal stromal tumor (GIST). However, the treatment must be taken indefinitely, it is not devoid of inconvenience and toxicity. Moreover, resistance or escape from disease control occurs in a significant number of patients. Imatinib is a substrate of the cytochromes P450 CYP3A4/5 and of the multidrug transporter P-glycoprotein (product of the MDR1 gene). Considering the large inter-individual differences in the expression and function of those systems, the disposition and clinical activity of imatinib can be expected to vary widely among patients, calling for dosage individualization. The aim of this exploratory study was to determine the average pharmacokinetic parameters characterizing the disposition of imatinib in the target population, to assess their inter-individual variability, and to identify influential factors affecting them. A total of 321 plasma concentrations, taken at various sampling times after the latest dose, were measured in 59 patients receiving Glivec at diverse regimens, using a validated HPLC-UV method developed for this study. The results were analyzed by non-linear mixed effect modeling (NONMEM). A one-compartment model with first-order absorption appeared appropriate to describe the data, with an average apparent clearance of 12.4 l/h, a distribution volume of 268 l and an absorption constant of 0.47 h-1. The clearance was affected by body weight, age and sex. No influences of interacting drugs were found. DNA samples were used for pharmacogenetic explorations. At present, only the MDR1 polymorphism has been assessed and seems to affect the pharmacokinetic parameters of imatinib. Large inter-individual variability remained unexplained by the demographic covariates considered, both on clearance (40 %) and distribution volume (71 %). Together with intra-patient variability (34 %), this translates into an 8-fold width of the 90 %-prediction interval of plasma concentrations expected under a fixed dosing regimen. This is a strong argument to further investigate the possible usefulness of a therapeutic drug monitoring program for imatinib. It may help to individualize the dosing regimen before overt disease progression or observation of treatment toxicity, thus improving both the long-term therapeutic effectiveness and tolerability of this drug.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Building a personalized model to describe the drug concentration inside the human body for each patient is highly important to the clinical practice and demanding to the modeling tools. Instead of using traditional explicit methods, in this paper we propose a machine learning approach to describe the relation between the drug concentration and patients' features. Machine learning has been largely applied to analyze data in various domains, but it is still new to personalized medicine, especially dose individualization. We focus mainly on the prediction of the drug concentrations as well as the analysis of different features' influence. Models are built based on Support Vector Machine and the prediction results are compared with the traditional analytical models.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introduction: We launched an investigator-initiated study (ISRCTN31181395) to evaluate the potential benefit of pharmacokinetic-guided dosage individualization of imatinib for leukaemiapatients followed in public and private sectors. Following approval by the research ethics committee (REC) of the coordinating centre, recruitment throughout Switzerland necessitatedto submit the protocol to 11 cantonal RECs.Materials and Methods: We analysed requirements and evaluation procedures of the 12 RECs with associated costs.Results: 1-18 copies of the dossier, in total 4300 printed pages, were required (printing/posting costs: ~300 CHF) to meet initial requirements. Meeting frequencies of RECs ranged between 2 weeks and 2 months, time from submission to fi rst feedback took 2-75 days. Study approval was obtained from a chairman, a subor the full committee, the evaluation work being invoiced by0-1000 CHF (median: 750 CHF, total: 9200 CHF). While 5 RECs gave immediate approval, the other 6 rose in total 38 queries before study release, mainly related to wording in the patient information, leading to 7 different fi nal versions approved. Submission tasks employed an investigator half-time over about 6 months.Conclusion: While the necessity of clinical research evaluation by independent RECs is undisputed, there is a need of further harmonization and cooperation in evaluation procedures. Current administrative burden is indeed complex, time-consuming and costly. A harmonized electronic application form, preferably compatible with other regulatory bodies and European countries, could increase transparency, improve communication, and encourage academic multi-centre clinical research in Switzerland.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Machine learning has been largely applied to analyze data in various domains, but it is still new to personalized medicine, especially dose individualization. In this paper, we focus on the prediction of drug concentrations using Support Vector Machines (S VM) and the analysis of the influence of each feature to the prediction results. Our study shows that SVM-based approaches achieve similar prediction results compared with pharmacokinetic model. The two proposed example-based SVM methods demonstrate that the individual features help to increase the accuracy in the predictions of drug concentration with a reduced library of training data.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Drug development has improved over recent decades, with refinements in analytical techniques, population pharmacokinetic-pharmacodynamic (PK-PD) modelling and simulation, and new biomarkers of efficacy and tolerability. Yet this progress has not yielded improvements in individualization of treatment and monitoring, owing to various obstacles: monitoring is complex and demanding, many monitoring procedures have been instituted without critical assessment of the underlying evidence and rationale, controlled clinical trials are sparse, monitoring procedures are poorly validated and both drug manufacturers and regulatory authorities take insufficient account of the importance of monitoring. Drug concentration and effect data should be increasingly collected, analyzed, aggregated and disseminated in forms suitable for prescribers, along with efficient monitoring tools and evidence-based recommendations regarding their best use. PK-PD observations should be collected for both novel and established critical drugs and applied to observational data, in order to establish whether monitoring would be suitable. Methods for aggregating PK-PD data in systematic reviews should be devised. Observational and intervention studies to evaluate monitoring procedures are needed. Miniaturized monitoring tests for delivery at the point of care should be developed and harnessed to closed-loop regulated drug delivery systems. Intelligent devices would enable unprecedented precision in the application of critical treatments, i.e. those with life-saving efficacy, narrow therapeutic margins and high interpatient variability. Pharmaceutical companies, regulatory agencies and academic clinical pharmacologists share the responsibility of leading such developments, in order to ensure that patients obtain the greatest benefit and suffer the least harm from their medicines.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study aimed to compare two different maximal incremental tests with different time durations [a maximal incremental ramp test with a short time duration (8-12 min) (STest) and a maximal incremental test with a longer time duration (20-25 min) (LTest)] to investigate whether an LTest accurately assesses aerobic fitness in class II and III obese men. Twenty obese men (BMI≥35 kg.m-2) without secondary pathologies (mean±SE; 36.7±1.9 yr; 41.8±0.7 kg*m-2) completed an STest (warm-up: 40 W; increment: 20 W*min-1) and an LTest [warm-up: 20% of the peak power output (PPO) reached during the STest; increment: 10% PPO every 5 min until 70% PPO was reached or until the respiratory exchange ratio reached 1.0, followed by 15 W.min-1 until exhaustion] on a cycle-ergometer to assess the peak oxygen uptake [Formula: see text] and peak heart rate (HRpeak) of each test. There were no significant differences in [Formula: see text] (STest: 3.1±0.1 L*min-1; LTest: 3.0±0.1 L*min-1) and HRpeak (STest: 174±4 bpm; LTest: 173±4 bpm) between the two tests. Bland-Altman plot analyses showed good agreement and Pearson product-moment and intra-class correlation coefficients showed a strong correlation between [Formula: see text] (r=0.81 for both; p≤0.001) and HRpeak (r=0.95 for both; p≤0.001) during both tests. [Formula: see text] and HRpeak assessments were not compromised by test duration in class II and III obese men. Therefore, we suggest that the LTest is a feasible test that accurately assesses aerobic fitness and may allow for the exercise intensity prescription and individualization that will lead to improved therapeutic approaches in treating obesity and severe obesity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper applies probability and decision theory in the graphical interface of an influence diagram to study the formal requirements of rationality which justify the individualization of a person found through a database search. The decision-theoretic part of the analysis studies the parameters that a rational decision maker would use to individualize the selected person. The modeling part (in the form of an influence diagram) clarifies the relationships between this decision and the ingredients that make up the database search problem, i.e., the results of the database search and the different pairs of propositions describing whether an individual is at the source of the crime stain. These analyses evaluate the desirability associated with the decision of 'individualizing' (and 'not individualizing'). They point out that this decision is a function of (i) the probability that the individual in question is, in fact, at the source of the crime stain (i.e., the state of nature), and (ii) the decision maker's preferences among the possible consequences of the decision (i.e., the decision maker's loss function). We discuss the relevance and argumentative implications of these insights with respect to recent comments in specialized literature, which suggest points of view that are opposed to the results of our study.

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent studies of cancer patients revealed high diversity in oncogenic mechanisms, leading to increased treatment individualization for subgroups of patients with frequent cancers. A similar development may not be possible for patients with rare cancers, such as Merkel cell carcinoma (MCC). Finding shared disease mechanisms may open new options to understanding and treating such tumors. Tumor-infiltrating CD8+ T cells are frequently associated with favorable clinical outcome in a remarkably large spectrum of cancers. In this issue, Afanasiev et al. suggest a mechanism that may hinder the tumor homing of CD8+ T cells in MCC patients. It is possible that therapeutic mobilization of anti-cancer T cells may be useful in patients who share this specific immune biological feature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

La forma en que adolescentes y jóvenes utilizan las tecnologías de la información y la comunicación es diferente a la de la población adulta. Las prácticas son más intensivas y extensivas entre l@s más jóvenes, tal y como muestran las estadísticas disponibles. Este resultado, ampliamente conocido, nos lleva a preguntarnos ¿qué implicaciones tienen estas prácticas comunicativas de las generaciones más jóvenes?Tomando como punto de partida algunos estudios que analizan la situación, tanto en España como en otros países, revisaremos los cambios que ya se están produciendo en ámbitos que van desde el aprendizaje a la socialización. Revisaremos, asimismo, algunas propuestas que intentan dar una explicación teórica global de las prácticas y las actitudes comunicativas de jóvenes y adolescentes. En el análisis tendremos en cuenta el creciente proceso de individualización de nuestras sociedades y la presencia habitual de comunidades de práctica permanentemente conectadas que caracterizan a estas generaciones.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of the paper is to describe some of the challenges faced by schools, or by formal education in general, as a consequence of today"s mobilecentric society (henceforth MCS), the term we will use to denote the new, networked learning ecology that has arisen from the massive penetration of digital media in everyday life. After revisiting some of the ideas of McLuhan and Vygotsky in the light of this new technological scenario, we describe five traits of the MCS and the challenges illustrated through educational practices that we believe schools will face if they wish to preserve their function of individualization and socialization. We believe that despite the emergence of the MCS, the main function of the school is still to provide the"box of tools" (a set of psychological instruments, such as reading, writing, mathematical notation, digital literacy, etc.) that enables people to develop their learning skills and life projects and to become part of communities and groups. However, the complexity and mobility of the new learning environments means that the position held by schools needs to be reevaluated in the face of the informal learning paths and experiences both online and offline to which learners now have access. We also need to reevaluate the meaning of the school itself as an institution and the model of learner it should be training