991 resultados para Fragile-X Premutation
Resumo:
The human genome contains many repeated DNA sequences that vary in complexity of repeating unit from a single nucleotide to a whole gene. The repeat sequences can be widely dispersed or in simple tandem arrays. Arrays of up to 5 or 6 nt are known as simple tandem repeats, and these are widely dispersed and highly polymorphic. Members of one group of the simple tandem repeats, the trinucleotide repeats, can undergo an increase in copy number by a process of dynamic mutation. Dynamic mutations of the CCG trinucleotide give rise to one group of fragile sites on human chromosomes, the rare folate-sensitive group. One member of this group, the fragile X (FRAXA) is responsible for the most common familial form of mental retardation. Another member of the group FRAXE is responsible for a rarer mild form of mental retardation. Similar mutations of AGC repeats give rise to a number of neurological disorders. The expanded repeats are unstable between generations and somatically. The intergenerational instability gives rise to unusual patterns of inheritance--particularly anticipation, the increasing severity and/or earlier age of onset of the disorder in successive generations. Dynamic mutations have been found only in the human species, and possible reasons for this are considered. The mechanism of dynamic mutation is discussed, and a number of observations of simple tandem repeat mutation that could assist in understanding this phenomenon are commented on.
Resumo:
Fragile X syndrome (FXS) is the most common form of inherited mental retardation in humans. FXS is caused by loss of the Fragile X Mental Retardation Protein (FMRP), an important regulator of neuronal mRNA translation. Patients with FXS display cognitive deficits including memory problems. Protein synthesis-dependent long-term changes in synaptic plasticity are involved in the establishment and maintenance of long-term memory. One prevalent theory of FXS pathology predicts that FMRP is required to negatively regulate the translation of important mRNAs at the synapse. We are investigating microRNAs (miRNAs) as a potential regulator of synaptic FMRP-regulated mRNAs that have previously been described as being crucial to the process of synaptic plasticity. The general hypothesis underlying this thesis is that FMRP may negatively regulate the expression of futsch (the Drosophila homologue of the microtubule-associated protein gene MAP1B) via the miRNA pathway. The first step we took in testing this hypothesis was to confirm that futsch is subject to miRNA-mediated translational control. Using in silico target analysis, we predicted that several neuronally expressed miRNAs target the futsch mRNA 3'UTR and repress expression of Futsch protein. Then, using an in vitro luciferase reporter system, we showed that miR-315 and members of the miR-9 family selectively down-regulated futsch reporter translation. We have confirmed by site- directed mutagenesis that the miRNA interaction with the futsch 3'UTR is specific to the miRNA seed region binding site. Interestingly, reduction of FMRP levels by RNAi had no effect on futsch 3'UTR reporter expression. Together, these data suggest regulation of futsch expression by the miRNA pathway might be independent of FMRP activity. However, additional experiments need to be completed to confirm these preliminary results.
Resumo:
Post-transcriptional regulation of mRNA is facilitated by different mechanisms, such as microRNA (miRNA) induced gene silencing or fragile X mental retardation protein (FMRP) mediated repression either independent of or acting through cytoplasmic RNA Processing bodies (P bodies). DPTP99A, Lar, and Wg have known functions during synaptogenesis and may be targets of miR-8. Here, we provide evidence that miR-8 regulates DPTP99A in vitro. Non-endogenous miR-8 expressed using an UAS driver regulates Lar. Endogenous miR-8 may regulate DPTP99A in vivo. Here we show that FMRP is capable of colocalizing with the P body components: DCP1, HPat, and Me31B, but not CCR4. We also show that RNAi against HPat and Me31B but not CCR4 and DCP1 are required for FMRP’s repression of a translational reporter in vivo. This functional analysis provides additional insight into another aspect of FMRP’s and P bodies’ ability to cooperatively control repression of mRNA targets.
Resumo:
Increasing evidence suggests that the development and function of the nervous system is heavily dependent on RNA editing and the intricate spatiotemporal expression of a wide repertoire of non-coding RNAs, including micro RNAs, small nucleolar RNAs and longer non-coding RNAs. Non-coding RNAs may provide the key to understanding the multi-tiered links between neural development, nervous system function, and neurological diseases.
Resumo:
This review summarizes evidence of dysregulated reward circuitry function in a range of neurodevelopmental and psychiatric disorders and genetic syndromes. First, the contribution of identifying a core mechanistic process across disparate disorders to disease classification is discussed, followed by a review of the neurobiology of reward circuitry. We next consider preclinical animal models and clinical evidence of reward-pathway dysfunction in a range of disorders, including psychiatric disorders (i.e., substance-use disorders, affective disorders, eating disorders, and obsessive compulsive disorders), neurodevelopmental disorders (i.e., schizophrenia, attention-deficit/hyperactivity disorder, autism spectrum disorders, Tourette's syndrome, conduct disorder/oppositional defiant disorder), and genetic syndromes (i.e., Fragile X syndrome, Prader-Willi syndrome, Williams syndrome, Angelman syndrome, and Rett syndrome). We also provide brief overviews of effective psychopharmacologic agents that have an effect on the dopamine system in these disorders. This review concludes with methodological considerations for future research designed to more clearly probe reward-circuitry dysfunction, with the ultimate goal of improved intervention strategies.
Resumo:
Spectrum Disorder (ASD), is a heterogeneous neurodevelopmental disorder with na estimated global prevalence rate of 17:10000, and a male to female ratio of 4:1. Patients with ASD presente language and communication difficulties and stereotyped behaviours. Comorbidity with other disorders, such as Intelectual Disability, Fragile-X syndrome (FXS) epilepsy and tuberous sclerosis frequently occurs. ASD presents amultifactorial etiopathology, and genetic factos alone are not suficiente to explain how the syndrome arises, with recente studies establishing ASD heritability at approximately 50%. Pre-, peri- and post-natal exposure to toxic environmental factos has been implicated in the development of ASD. Involvement of epigenetic regulatory mechanisms has been suggested, supported by the occurrence of autistic symptoms in patients with disorders aris ing from epigenetic mutations, such as FXS. A polygenic and epistatic model is a strong hypothesis to explain ASD. The main goal of this project is to identify specific exposure patterns to environmental toxicants in children diagnosed with ASD and integrate the results with genetic and epigenetic data.
Resumo:
Las enfermedades raras o huérfano son una problemática que ha tomado mucha importancia en el contexto mundial del presente siglo, estas se han definido como crónicas, de difícil tratamiento de sus síntomas y con baja prevalencia en la población; muchas de estas enfermedades cursan con varios tipos de discapacidad, siendo el objetivo del presente trabajo el enfocarse en aquellas enfermedades raras que cursan con discapacidad intelectual. Para poder profundizar en estas enfermedades se realizó una revisión teórica sobre las enfermedades raras, así como de la discapacidad psíquica y su importancia a nivel mundial y nacional. A partir de estas definiciones, se revisaron en profundidad 3 enfermedades raras que cursan con discapacidad intelectual en el contexto colombiano, como son: el síndrome de Rett, el síndrome de Prader-Willi y el síndrome de X frágil. En cada una de estas enfermedades además se explicaron los tipos de diagnóstico, intervención, prevención, grupos de apoyo y tipos de evaluación que más se usan en el contexto nacional
Resumo:
The cytogenetic study of 182 river buffalo (Bubalus bubalis L., 2n=50) of Murrah, Mediterranean and Jaffarabadi breeds, from the State of São Paulo, was carried out to characterize their chromosomes and to detect possible chromosomal abnormalities. The karyotypes were indistinguishable with conventional staining as well as with C and replication R banding techniques. In about 44% of the sample (8 males and 72 females), an X marker chromosome due to a fragile site was shown. The frequency of metaphases expressing the fragility site on the X was highly variable, from 2.86 to 41.03%. In females, the fragile site, rarely appeared on both X chromosomes. Most of the metaphases showed only 1 marker chromosome. In R-banded metaphases using 5-bromodeoxyuridine (BrdU) treatment, it corresponded in general to the late replicating X chromosome. No correlation between the X fragile site and altered phenotype was found. Structural and numerical chromosome rearrangements were ruled out in the present sample of buffalo. (C) 1998 by Elsevier B.V.
Resumo:
Il seguente lavoro di tesi verte sulla ricerca-azione formazione triennale “Il Filo di Arianna” realizzata in convenzione tra Associazione Italiana Sindrome X Fragile e Dipartimento Di Scienze dell’Educazione – Università di Bologna, finalizzata alla superamento degli handicap che la X fragile propone. La ricerca ha un fuoco in Pedagogia Speciale e un carattere multidisciplinare e inter istituzionale grazie alla sinergia con l’area neuroriabilitativa (Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) San Raffaele Pisana di Roma) e l’area della Psicologia Clinica (Ospedale Bambin Gesù di Roma). Il lavoro di tesi descrive il percorso per giungere alle linee guida di intervento scaturite dalla ricerca, per il potenziamento cognitivo ed affettivo di bambini e persone con x fragile nei contesti di casa, scuola e tempo libero.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
It is possible to distribute the 17 autosomic fragile sites presently known in three categories according to their sensitivity: BrdU-sensitive sites (10q25, 16q22, 17p12), distamycin A-sensitive sites (16q22, 17p12) and folate- and thymidilate-sensitive sites (2q11-q14, 3p14, 6p23, 7p11, 8q22, 9p21, 9q32, 10q23, 11q13, 11q23, 12q13, 16p12, 16q23, 17p12, 20p11). Four fundamental problems are discussed, first the relation between the presence of a fragile site and the phenotype, secondly the incidence of autosomic sites, third the origin of fragility (particularity of DNA structure, defect of the DNA/proteins binding and abnormal arrangement of chromatin, abnormality of the metaphasic scaffold) and fourth the localization of fragile sites.
Resumo:
The tenth volume of College Papers contains original documents dating from 1821 to 1824, spanning the tenures of president John Thornton Kirkland and treasurer John Davis. Much of the volume consists of general administrative correspondence exchanged between Kirkland and Davis, as well as correspondence between Davis and Steward Stephen Higginson. It also contains a printed document from 1831, during the tenure of president Josiah Quincy.
Resumo:
The tenth volume of College Papers contains original documents dating from 1821 to 1824, spanning the tenures of president John Thornton Kirkland and treasurer John Davis. Much of the volume consists of general administrative correspondence exchanged between Kirkland and Davis, as well as correspondence between Davis and Steward Stephen Higginson. It also contains a printed document from 1831, during the tenure of president Josiah Quincy.