993 resultados para FIA-stripping detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

El daño cerebral adquirido (DCA) es un problema social y sanitario grave, de magnitud creciente y de una gran complejidad diagnóstica y terapéutica. Su elevada incidencia, junto con el aumento de la supervivencia de los pacientes, una vez superada la fase aguda, lo convierten también en un problema de alta prevalencia. En concreto, según la Organización Mundial de la Salud (OMS) el DCA estará entre las 10 causas más comunes de discapacidad en el año 2020. La neurorrehabilitación permite mejorar el déficit tanto cognitivo como funcional y aumentar la autonomía de las personas con DCA. Con la incorporación de nuevas soluciones tecnológicas al proceso de neurorrehabilitación se pretende alcanzar un nuevo paradigma donde se puedan diseñar tratamientos que sean intensivos, personalizados, monitorizados y basados en la evidencia. Ya que son estas cuatro características las que aseguran que los tratamientos son eficaces. A diferencia de la mayor parte de las disciplinas médicas, no existen asociaciones de síntomas y signos de la alteración cognitiva que faciliten la orientación terapéutica. Actualmente, los tratamientos de neurorrehabilitación se diseñan en base a los resultados obtenidos en una batería de evaluación neuropsicológica que evalúa el nivel de afectación de cada una de las funciones cognitivas (memoria, atención, funciones ejecutivas, etc.). La línea de investigación en la que se enmarca este trabajo de investigación pretende diseñar y desarrollar un perfil cognitivo basado no sólo en el resultado obtenido en esa batería de test, sino también en información teórica que engloba tanto estructuras anatómicas como relaciones funcionales e información anatómica obtenida de los estudios de imagen. De esta forma, el perfil cognitivo utilizado para diseñar los tratamientos integra información personalizada y basada en la evidencia. Las técnicas de neuroimagen representan una herramienta fundamental en la identificación de lesiones para la generación de estos perfiles cognitivos. La aproximación clásica utilizada en la identificación de lesiones consiste en delinear manualmente regiones anatómicas cerebrales. Esta aproximación presenta diversos problemas relacionados con inconsistencias de criterio entre distintos clínicos, reproducibilidad y tiempo. Por tanto, la automatización de este procedimiento es fundamental para asegurar una extracción objetiva de información. La delineación automática de regiones anatómicas se realiza mediante el registro tanto contra atlas como contra otros estudios de imagen de distintos sujetos. Sin embargo, los cambios patológicos asociados al DCA están siempre asociados a anormalidades de intensidad y/o cambios en la localización de las estructuras. Este hecho provoca que los algoritmos de registro tradicionales basados en intensidad no funcionen correctamente y requieran la intervención del clínico para seleccionar ciertos puntos (que en esta tesis hemos denominado puntos singulares). Además estos algoritmos tampoco permiten que se produzcan deformaciones grandes deslocalizadas. Hecho que también puede ocurrir ante la presencia de lesiones provocadas por un accidente cerebrovascular (ACV) o un traumatismo craneoencefálico (TCE). Esta tesis se centra en el diseño, desarrollo e implementación de una metodología para la detección automática de estructuras lesionadas que integra algoritmos cuyo objetivo principal es generar resultados que puedan ser reproducibles y objetivos. Esta metodología se divide en cuatro etapas: pre-procesado, identificación de puntos singulares, registro y detección de lesiones. Los trabajos y resultados alcanzados en esta tesis son los siguientes: Pre-procesado. En esta primera etapa el objetivo es homogeneizar todos los datos de entrada con el objetivo de poder extraer conclusiones válidas de los resultados obtenidos. Esta etapa, por tanto, tiene un gran impacto en los resultados finales. Se compone de tres operaciones: eliminación del cráneo, normalización en intensidad y normalización espacial. Identificación de puntos singulares. El objetivo de esta etapa es automatizar la identificación de puntos anatómicos (puntos singulares). Esta etapa equivale a la identificación manual de puntos anatómicos por parte del clínico, permitiendo: identificar un mayor número de puntos lo que se traduce en mayor información; eliminar el factor asociado a la variabilidad inter-sujeto, por tanto, los resultados son reproducibles y objetivos; y elimina el tiempo invertido en el marcado manual de puntos. Este trabajo de investigación propone un algoritmo de identificación de puntos singulares (descriptor) basado en una solución multi-detector y que contiene información multi-paramétrica: espacial y asociada a la intensidad. Este algoritmo ha sido contrastado con otros algoritmos similares encontrados en el estado del arte. Registro. En esta etapa se pretenden poner en concordancia espacial dos estudios de imagen de sujetos/pacientes distintos. El algoritmo propuesto en este trabajo de investigación está basado en descriptores y su principal objetivo es el cálculo de un campo vectorial que permita introducir deformaciones deslocalizadas en la imagen (en distintas regiones de la imagen) y tan grandes como indique el vector de deformación asociado. El algoritmo propuesto ha sido comparado con otros algoritmos de registro utilizados en aplicaciones de neuroimagen que se utilizan con estudios de sujetos control. Los resultados obtenidos son prometedores y representan un nuevo contexto para la identificación automática de estructuras. Identificación de lesiones. En esta última etapa se identifican aquellas estructuras cuyas características asociadas a la localización espacial y al área o volumen han sido modificadas con respecto a una situación de normalidad. Para ello se realiza un estudio estadístico del atlas que se vaya a utilizar y se establecen los parámetros estadísticos de normalidad asociados a la localización y al área. En función de las estructuras delineadas en el atlas, se podrán identificar más o menos estructuras anatómicas, siendo nuestra metodología independiente del atlas seleccionado. En general, esta tesis doctoral corrobora las hipótesis de investigación postuladas relativas a la identificación automática de lesiones utilizando estudios de imagen médica estructural, concretamente estudios de resonancia magnética. Basándose en estos cimientos, se han abrir nuevos campos de investigación que contribuyan a la mejora en la detección de lesiones. ABSTRACT Brain injury constitutes a serious social and health problem of increasing magnitude and of great diagnostic and therapeutic complexity. Its high incidence and survival rate, after the initial critical phases, makes it a prevalent problem that needs to be addressed. In particular, according to the World Health Organization (WHO), brain injury will be among the 10 most common causes of disability by 2020. Neurorehabilitation improves both cognitive and functional deficits and increases the autonomy of brain injury patients. The incorporation of new technologies to the neurorehabilitation tries to reach a new paradigm focused on designing intensive, personalized, monitored and evidence-based treatments. Since these four characteristics ensure the effectivity of treatments. Contrary to most medical disciplines, it is not possible to link symptoms and cognitive disorder syndromes, to assist the therapist. Currently, neurorehabilitation treatments are planned considering the results obtained from a neuropsychological assessment battery, which evaluates the functional impairment of each cognitive function (memory, attention, executive functions, etc.). The research line, on which this PhD falls under, aims to design and develop a cognitive profile based not only on the results obtained in the assessment battery, but also on theoretical information that includes both anatomical structures and functional relationships and anatomical information obtained from medical imaging studies, such as magnetic resonance. Therefore, the cognitive profile used to design these treatments integrates information personalized and evidence-based. Neuroimaging techniques represent an essential tool to identify lesions and generate this type of cognitive dysfunctional profiles. Manual delineation of brain anatomical regions is the classical approach to identify brain anatomical regions. Manual approaches present several problems related to inconsistencies across different clinicians, time and repeatability. Automated delineation is done by registering brains to one another or to a template. However, when imaging studies contain lesions, there are several intensity abnormalities and location alterations that reduce the performance of most of the registration algorithms based on intensity parameters. Thus, specialists may have to manually interact with imaging studies to select landmarks (called singular points in this PhD) or identify regions of interest. These two solutions have the same inconvenient than manual approaches, mentioned before. Moreover, these registration algorithms do not allow large and distributed deformations. This type of deformations may also appear when a stroke or a traumatic brain injury (TBI) occur. This PhD is focused on the design, development and implementation of a new methodology to automatically identify lesions in anatomical structures. This methodology integrates algorithms whose main objective is to generate objective and reproducible results. It is divided into four stages: pre-processing, singular points identification, registration and lesion detection. Pre-processing stage. In this first stage, the aim is to standardize all input data in order to be able to draw valid conclusions from the results. Therefore, this stage has a direct impact on the final results. It consists of three steps: skull-stripping, spatial and intensity normalization. Singular points identification. This stage aims to automatize the identification of anatomical points (singular points). It involves the manual identification of anatomical points by the clinician. This automatic identification allows to identify a greater number of points which results in more information; to remove the factor associated to inter-subject variability and thus, the results are reproducible and objective; and to eliminate the time spent on manual marking. This PhD proposed an algorithm to automatically identify singular points (descriptor) based on a multi-detector approach. This algorithm contains multi-parametric (spatial and intensity) information. This algorithm has been compared with other similar algorithms found on the state of the art. Registration. The goal of this stage is to put in spatial correspondence two imaging studies of different subjects/patients. The algorithm proposed in this PhD is based on descriptors. Its main objective is to compute a vector field to introduce distributed deformations (changes in different imaging regions), as large as the deformation vector indicates. The proposed algorithm has been compared with other registration algorithms used on different neuroimaging applications which are used with control subjects. The obtained results are promising and they represent a new context for the automatic identification of anatomical structures. Lesion identification. This final stage aims to identify those anatomical structures whose characteristics associated to spatial location and area or volume has been modified with respect to a normal state. A statistical study of the atlas to be used is performed to establish which are the statistical parameters associated to the normal state. The anatomical structures that may be identified depend on the selected anatomical structures identified on the atlas. The proposed methodology is independent from the selected atlas. Overall, this PhD corroborates the investigated research hypotheses regarding the automatic identification of lesions based on structural medical imaging studies (resonance magnetic studies). Based on these foundations, new research fields to improve the automatic identification of lesions in brain injury can be proposed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A flow injection method for the quantitative analysis of ketoconazole in tablets, based on the reaction with iron (III) ions, is presented. Ketoconazole forms a red complex with iron ions in an acid medium, with maximum absorbance at 495 nm. The detection limit was estimated to be 1×10--4 mol L-1; the quantitation limit is about 3×10--4 mol L-1 and approximately 30 determinations can be performed in an hour. The results were compared with those obtained with a reference HPLC method. Statistical comparisons were done using the Student's t procedure and the F test. Complete agreement was found at the 0.95 significance level between the proposed flow injection and the HPLC procedures. The two methods present similar precision, i.e., for HPLC the mean relative standard deviation was ca. 1.2% and for FIA ca. 1.6%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.