History of La Grange military academy and the cadet corps, 1857-1862, La Grange college, 1830-1857,

Mode of access: Internet.

Behaviour of albino and melanic variants of Biomphalaria glabrata Say, 1818 (Mollusca: Planorbidae) following infection by Schistosoma mansoni Sambon, 1907

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

The myth of the nation: Historiography of New Zealand architecture since 1907

This paper considers the relationship between the recent historiography (of the last quarter century) of “New Zealand architecture” and the historical notion of “New Zealand-ness” invoked in contemporary architecture. It argues that a more recent programmatic uptake of post-War discussions on national identity and regional specificity has fed the tendencies of practicing architects to defer to history in rhetorical defences of their work: the beach-side mansion as a contemporary expression of the 1950s bach; a formal modernism divorced from the social discourse adherent to the historical moment that it “restates”; and so on. The paper will consider instances in the historiography of New Zealand architecture where historians have compounded, consciously or accidentally, a problem that is systemic to the uses made by architects of historical knowledge (in the most general examples), identifying the difficulties of relying upon the tentative conclusions of an under-studied field in developing principles of contemporary architectural practice under the banners of New Zealand-ness, regionalism, or localism, or with reference to icons of New Zealand architectural history. At the heart of this paper is a reflection on historiographical responsibility in presenting knowledge of a national past to an audience that is eager to transform that knowledge into principles of contemporary production. What, the paper asks, is the historical basis for speaking of a New Zealand architecture? Can we speak of a national history of architecture distinct from a regional history, or from an international history of architecture?

The Australian mortality decline: cause-specific mortality 1907-1990

This review describes the changes in composition of mortality by major attributed cause during the Australian mortality decline this century. The principal categories employed were: infectious diseases, nonrheumatic cardiovascular disease, external causes, cancer,'other' causes and ill-defined conditions. The data were age-adjusted. Besides registration problems (which also affect all-cause mortality) artefacts due to changes in diagnostic designation and coding-are evident. The most obvious trends over the period are the decline in infectious disease mortality (half the decline 1907-1990 occurs before 1949), and the epidemic of circulatory disease mortality which appears to commence around 1930, peaks during the 1950s and 1960s, and declines from 1970 to 1990 (to a rate half that at the peak). Mortality for cancer remains static for females after 1907, but increases steadily for males, reaching a plateau in the mid-1980s (owing to trends in lung cancer); trends in cancers of individual sites are diverse. External cause mortality declines after 1970. The decline in total mortality to 1930 is associated with decline in infection and 'other' causes, Stagnation of mortality decline in 1930-1940 and 1946-1970 for males is a consequence of contemporaneous movements in opposite directions of infection mortality (decrease) and circulatory disease and cancer mortality (increase). In females, declines in infections and 'other' causes of death exceed the increase in circulatory disease mortality until 1960, then stability in all major causes of death to 1970. The overall mortality decline since 1970 is a consequence of a reduction in circulatory disease,'other' cause, external cause and infection mortality, despite the increase in cancer mortality (for males).

Lepocreadiidae (Digenea) of Australian coastal fishes: new species of Opechona Looss, 1907, Lepotrema Ozaki, 1932 and Bianium Stunkard, 1930 and comments on other species reported for the first time or poorly known in Australian waters

Opechona austrobacillaris n, sp. is described from Pomatomus saltatrix from marine sites off Western Australia and New South Wales, Australia. It differs from O. bacillaris in its elongate outline, small ventral sucker, longer pseudoesophagus (relative to the oesophagus), relatively shorter ventral sucker to ovary distance and the relatively longer post-testicular region. Lepotrema monile n. sp. is described from Pomacentrus wardi from Heron Island, Queensland. It differs from its congeners in the sphincter around the distal metraterm and the more-or-less oval ovary. Bianium spongiosum n. sp, is described from Ostracion cubicus from Lizard Island, Queensland. It differs from its congeners in lacking lateral flaps in the forebody, but in having large, internal spongiform patches in the lateral forebody. The following species are redescribed from Australian sites: Lepocreadium oyabitcha from Abudefduf whitleyi, Lizard Island; Clavogalea trachinoti from Trachinotus botla, Heron Island and T. coppingeri, New South Wales, Stradbroke Island, Queensland and Heron Island; Myzoxenus insolens from Notolabrus parilus, Western Australia; Bulbocirrus aulostomi from Aulostomus chinensis, Heron Island; Lepocreadioides orientalis [new synonyms: Bicaudum interruptum Bilqees, 1973; Lepocreadioides interruptum (Bilqees, 1973) Madhavi, Narasimhulu & Shameem, 1986; Lepocreadioides discum Wang, 1986; Lepocreadioides sp. of Karyakarte & Yadav (1976)] from Cynoglossus bilineata, Moreton Bay, Queensland; Hypocreadium patellare from Sufflamen chrysopterus, Heron Island; Echeneidocoelium indicum from Echeneis naucrates, Heron Island; Multitestis pyriformis from Epinephelus cyanopodus, Heron Island; Pseudopisthogonoporus vitellosus from Naso brevirostris, Heron Island; and Bianium hispidum from Torquigener whitleyi and T. pleurogramma, southern Queensland. Only M. solens and M. pyriformis have been reported from Australian waters before; both are new host records.

A new species of Aponurus looss, 1907 (Digenea : Lecithasteridae) in butterflyfishes (Perciformes : Chaetodontidae) from New Caledonia

Aponurus chelebesoi n. sp. is described from Chaetodon auriga, C. citrinellus, C. ephippium, C. flavirostris, C. lineolatus, C. melannotus, C. mertensii, C. pelewensis, C. lunulatus, C. vagabundus, Coradion altivelis, Forcipiger flavissimus, Heniochus acuminatus, H. chrysostomus and H. monoceros from the southern coast of New Caledonia. It is distinguished from most species in the genera Aponurus (synonym Brachadena) and Lecithophyllum by its claviform (as opposed to oval to subglobular) vitelline lobes. Three species, A. pyriformis, Lecithophyllum vogeae and Brachadena cheilonis, have similar claviform vitelline lobes, but differ from A. chelebesoi in their tandem testes and the distinct egg-size.

New species of Opechona Looss, 1907 and Cephalolepidapedon Yamaguti, 1970 (Digenea: Lepocreadiidae) from fishes off northern Tasmania

Two new species of lepocreadiid trematodes are described from teleost fishes from off the coast of northern Tasmania. Opechona kahawai sp. nov. from Arripis sp. (Arripidae) differs from congeners by a combination of a longer prepharynx, longer excretory vesicle and the genital pore antero-sinistral to the ventral sucker. Cephalolepidapedon warehou sp. nov. from Seriolella punctata (Centrolophidae) differs from its only congener in the vitellarium reaching into the posterior forebody, a heavy concentration of eye-spot pigment in the forebody, a relatively narrower and more elongate body, a longer prepharynx and a more distinct oesophagus.

Ensino primário e matemática dos imigrantes e descendentes germânicos em Santa Leopoldina (1857-1907)

O objetivo da pesquisa é descrever o cenário da imigração germânica no século XIX, tratando também, de trilhar o caminho da educação por meio de educadores e das comunidades na Colônia de Santa Leopoldina, criada em 1857, na Província do Espírito Santo, considerando 50 anos a partir do início da imigração (1857-1907). A pesquisa histórica ancorou-se em consultas a documentos oficiais do Império, documentos e relatórios oficiais dos Presidentes da Província do Espírito Santo, jornais de circulação da época, fotografias, mapas geográficos, mapas estatísticos, livros didáticos antigos e livros de autores que abordaram o processo imigratório do Espírito Santo. O diálogo com Marc Bloch ajudou a entender essa multiplicidade de documentos, na complexa relação entre o passado e o presente da educação do Espírito Santo. O trabalho apresenta uma trajetória do imigrante germânico vindo da Europa até a ex-colônia e como a administração da província tratou a imigração e a educação. O ensino primário iniciou-se a partir de iniciativas públicas e particulares. Foram identificados as primeiras escolas e os nomes de muitos professores que atuaram no período estudado. Os livros utilizados nas escolas das comunidades teuto-brasileiras eram oriundos da Alemanha e posteriormente foram produzidos no sul do Brasil. Entre os livros escritos em alemão encontrados destacam-se o livro texto de alfabetização „Lese – Schule I für Deutsche Kinder in Brasilien‟, editado na Alemanha no final do século XIX, de autoria do diretor de uma escola particular em Santa Leopoldina, Albert Richard Dietze, e o primeiro volume do livro de matemática „Rechenbuch für Deutsch-Brasilianische Volksschulen‟, de Ferdinand Hackbart, Konrad Glaus e Hermann Lange. Foi feita uma análise sob os aspectos físicos e formais, o processo de ensino e os conteúdos do livro de matemática. A análise evidenciou que a proposta de ensino apoia-se no “cálculo mental” e o escrito, com a repetição dos conteúdos, envolvendo o treino intensivo. Os conceitos de matemática são apresentados partindo de problemas com situações concretas do aluno para a aquisição de competências necessárias para inserir o aluno em sua comunidade. Levando-se em conta que o livro foi editado em 1906, conclui-se que se trata de uma obra relevante com uma proposta de ensino que se manteve presente nos livros didáticos de matemática até os dias atuais.

Alguns dados referentes ao estudo parasitológico e anatomopatológico de duas linhagens de Schistosoma mansoni Sambon, 1907

Foi estudada a ação patogênica das linhagens de Schistosoma mansoni dos municípios de Belo Horizonte, MG e de São José dos Campos, SP (Brasil) observando maior capacidade patogênica da linhagem do primeiro, nas condições da experiência.