Avaliação da suplementação materna com megadose de vitamina a sobre os níveis de retinol e alfa-tocoferol no colostro

The vitamins A and E are recognizably important in the initial stages of life and the newborn depends on nutritional adequacy of breast milk to meet their needs. These vitamins share routes of transport to the tissues and antagonistic effects have been observed in animals after supplementation with vitamin A. This study aimed to verify the effect of maternal supplementation with vitamin A megadose (200,000 UI) in the immediate post-partum on the concentration of alpha-tocopherol in colostrum. Healthy parturient women attended at a public maternity natalensis were recruited for the study and divided into two groups: control (n = 37) and supplemented (n = 36). Blood samples of colostrum and milk were collected until 12 hours after delivery. The women of the supplemented group was administered a retynil palmitate capsule and 24 hours after the first collection was obtained the 2nd sample of colostrum in two groups for analysis of retinol and alpha-tocopherol in milk. The mean retinol concentration of 50,7 ± 14,4 μg/dL (Mean ± standard deviation) and alpha-tocopherol of 1217.4 ± 959 mg/dL in the serum indicate the nutritional status biochemical appropriate. Supplementation with retynil palmitate resulted in increase not only retinol levels in the colostrum of the supplemented group (p = 0.002), but also the concentration of alpha-tocopherol (p = 0.04), changing from 1456.6 ± 1095.8 mg/dL to 1804.3 ± 1432.0 mg/dL (milk 0 and 24 respectively) compared to values in the control group, 984.6 ± 750.0 mg/dL and 1175.0 ± 730.8 mg/dL. The women had different responses to supplementation, influenced by baseline levels of retinol in colostrum. Those with previous by low levels of retinol in colostrum (<60 mg/dL) had increased the concentration of alpha-tocopherol in milk, whereas those with adequate levels (> 60 mg/dL), showed a reduction after supplementation. Supplementation with retinol palmitate is an important intervention in situations of high risk for vitamin A deficiency, when considering the need to maternal supplementation, since the excess vitamin can offer unfavorable interactions between nutrients essential for the mother-child group

Diagnóstico molecular da talassemia ALFA+ (DELEÇÃO -3.7) em indivíduos com microcitose e/ou hipocromia

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Diagnóstico molecular da talassemia ALFA em indivíduos com microcitose e/ou hipocromia

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Avaliação dos níveis séricos de 17-alfa-OH progesterona e androstenediona durante o ciclo estral em marrãs (Sus Scrofa Domestica - Linnaeus, 1758)

No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.

Efeito do ácido alfa-lipóico sobre biomarcadores de estresse oxidativo, inflamação e fatores de risco cardiovascular em hipertensos

Alpha-lipoic acid (ALA) is a potent antioxidant with favourable anti-inflammatory, metabolic and endothelial effects, and has been widely investigated due to its potential against cardiovascular risk factors. This study aimed to evaluate the effect of oral ALA supplementation on oxidative stress biomarkers, inflammation and cardiovascular risk factors in patients with hypertension. This is a double-blind placebo-controlled randomized clinical trial, where the intervention was evaluated prospectively comparing results in both groups. The sample consisted of 64 hypertensive patients who were randomly distributed into ALA group (n = 32), receiving 600 mg / day ALA for twelve weeks and control group (n = 32), receiving placebo for the same period. The following parameters were evaluated before and after intervention: lipid peroxidation, content of reduced glutathione (GSH), enzymatic activities of glutathione peroxidase (GPx) and superoxide dismustase, ultrasensitive C-reactive protein (hs-CRP), triglycerides, total cholesterol and fractions, fasting glucose and anthropometric indicators. There was a statistically significant reduction (p <0.05) in serum concentrations of total cholesterol, very low density lipoprotein (VLDL), high density lipoprotein (HDL), triglycerides and blood glucose. There was a reduction in body weight and waist, abdominal and hip circumferences in the group that received ALA. In addition, there was a statistically significant increase (p <0.05) in the contents of reduced glutathione (GSH) and glutathione peroxidase (GPx) in the group receiving ALA. Oral administration of ALA appears to be a valuable adjuvant therapy, which may contribute to decrease the damage caused by oxidative stress and other risk factors associated with the atherosclerotic process

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comportamento elétrico a alta temperatura de termistor cerâmico alfa-Fe2O3 com coeficiente de temperatura negativo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prevalência de talassemia alfa+ (deleção -3.7) na população adulta do estado do Rio Grande do Norte

Alpha thalassemia, the most common monogenic disorder in the world, is characterized by deletions of one (+-thalassemia) or both alpha genes (0-thalassemia) located on human chromosome 16 (16p13.3). The most common case of +-thalassemia is a deletion of 3.7 kb of DNA (-3.7 deletion). It is most prevalent in African and Middle East regions. In the few studies carried out in Brazilian population -3.7 deletion was the most common deletion, mainly in African descendants. This study was conducted to determine the prevalence of +- thalassemia (deletion 3.7kb) in adult population from Rio Grande do Norte. We obtained blood samples from 713 unrelated individuals of both genders, aged between 18 and 59 years old. All individuals were born in Rio Grande do Norte. The hematological indices were obtained in an automatic cell counter (Micros 60, ABX Diagnostics). The hemoglobin measurement (A2 and Fetal hemoglobin) and the profile confirmation were carried out by high performance liquid chromatography (HPLC) methodology. Genomic DNA was obtained from peripheral blood leukocytes using Illustra Blood GenomicPrep Mini Spin kit and -3.7 deletion was investigated by PCR. Among the 713 individuals studied, 80 (11,2%) presented +- thalassemia: 79 (11,1%) were heterozygous and 1 (0,1%) homozygous for the -3.7 deletion. Considering the ethnic group, negroes showed the greatest prevalence of +-thalassemia (12,5%), followed by mulattoes (12,3%) and caucasian (9,6%). Statistical comparison of hematological parameters between normal individuals and heterozygous to +-thalassemia showed significant differences in RBC (p<0,001), MCV (p<0,001), MCH (p<0,001), Hb A2 (p=0,007) as well as female hemoglobin concentration (p=0,003). This is one of the first studies to research +-thalassemia in general population of Rio Grande do Norte state and these results attest the importance of investigation of this condition to define the etiology of microcytosis and hypochromia.

Endotoxemia por lipopolissacarídeo de Escherichia coli, em eqüinos: efeitos de antiinflamatórios nas concentrações sérica e peritoneal do fator de necrose tumoral alfa (TNF-alfa)

Avaliou-se a inibição da produção do fator de necrose tumoral alfa (TNF-alfa) devido ao pré-tratamento com antiinflamatório esteroidal (dexametasona) e não esteroidal (diclofenaco sódico) em eqüinos com endotoxemia induzida experimentalmente. Foram utilizados 15 cavalos machos não castrados, distribuídos em três grupos de cinco animais: controle (C), diclofenaco sódico (DS) e dexametasona (DM). A endotoxemia subletal foi induzida pela infusão intravenosa (IV) de 0,1mg/kg/pv de lipopolissacarídeo (LPS) de Escherichia coli 055:B5, administrado em 250ml de solução estéril de cloreto de sódio a 0,9%, durante 15min. Os cavalos do grupo-controle foram tratados com solução de cloreto de sódio a 9% IV. Nos animais do grupo DS, administraram-se, por via oral, 2,2mg/kg de diclofenaco sódico e, nos do grupo DM, 1,1mg/kg de dexametasona IV, respectivamente, 60 e 30min antes da infusão da endotoxina. Mensurou-se, por meio de ensaio de toxicidade com células da linhagem L929, a concentração de TNF-alfa no soro e no líquido peritoneal às 0, 1¼, 3 e 6 horas após injeção do LPS. No grupo-controle, observou-se aumento significativo de TNF-alfa sérico, em relação ao valor basal e aos grupos DS e DM, 1,15 horas após a indução da endotoxemia. No líquido peritoneal, as concentrações observadas estavam abaixo daquelas da curva padrão de TNF-alfa, não havendo diferença entre os grupos (P>0,05).

Avaliação do perfil hematológico de portadores de talassemia alfa provenientes das regiões Sudeste e Nordeste do Brasil

A talassemia alfa é uma anemia hereditária resultante da síntese deficiente de cadeias alfa, provocando um excesso relativo de cadeias beta, que vão formar tetrâmeros identificados como hemoglobina H (Hb H) no indivíduo adulto. Para direcionar o diagnóstico laboratorial desta anemia, a análise dos índices eritrocitários, a eletroforese em acetato de celulose em pH neutro e a pesquisa de corpos de inclusão de Hb H são essenciais. O objetivo deste estudo foi traçar o perfil hematológico, por meio dos índices eritrocitários, dos portadores de talassemia alfa das regiões Sudeste e Nordeste do Brasil. Foram analisadas 1.010 amostras de sangue periférico após consentimento informado. Os índices eritrocitários como contagem de glóbulos vermelhos (RBC), dosagem de hemoglobina (HGB), hematócrito (HCT), volume corpuscular médio (VCM), hemoglobina corpuscular média (HCM) e concentração de hemoglobina corpuscular média (CHCM) foram fornecidos por aparelhos automatizados com controle de qualidade interno e externo. Para o diagnóstico de talassemia alfa foram utilizados testes de triagem e complementares para talassemias, como eletroforese em pH neutro e pesquisa de corpos de inclusão de Hb H com coloração de azul cresil brilhante. Comparando-se os valores hematológicos observados nos dois grupos, notou-se que, em ambas as regiões, os índices com valores discrepantes foram os níveis de HGB e HCT, sendo a maior freqüência de variação observada entre as mulheres. Nos portadores do fenótipo alfa talassêmico da região Nordeste, todos os índices eritrocitários estavam abaixo dos valores de normalidade. Estes resultados evidenciam a necessidade de melhor avaliação do perfil hematológico de talassemia alfa em diferentes regiões, considerando-se os interferentes ambientais para um diagnóstico mais preciso.

Obtenção in situ do compósito alfa-SiAlON-SiC

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Influência do desenvolvimento etário e da suplementação com vitamina E (acetato de DL-alfa-tocoferol) no metabolismo oxidativo dos neutrófilos de bovinos da raça Holandesa (Bos taurus)

O presente trabalho teve por objetivo analisar a influência do desenvolvimento etário e da suplementação com acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos, em bovinos da raça holandesa, no período do nascimento até os 150 dias de idade. Foram utilizados 20 bezerros divididos em dois grupos de dez animais. Os animais do grupo Tratamento receberam 2000UI de acetato de DL-alfa-tocoferol, por via intramuscular, ao nascimento, aos 15, 30, 60, 90 e 120 dias de idade, sendo o outro o grupo Controle, que não recebeu qualquer suplementação. em ambos os grupos, o metabolismo oxidativo dos neutrófilos demonstrou pouca atividade durante os primeiros 60 dias de vida, sendo indicativo da ineficiência deste importante mecanismo bactericida. Não foi observado efeito significativo da administração do acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos.

Using pegylated interferon alfa-2b and ribavirin to treat chronic hepatitis patients infected with hepatitis C virus genotype 1: Are nonresponders and relapsers different populations?

The combination of pegylated interferon (PEG-INF) and ribavirin is currently the best treatment for chronic hepatitis C, providing a sustained virological response (SVR) in 54%-63% of patients. In patients infected with hepatitis C virus (HCV) genotype 1, the SVR rate is 42%-52%. To evaluate the treatment efficacy of this drug combination, we conducted an open, prospective study of 58 consecutive treatment-naive patients infected with HCV genotype 1 and treated at a university hospital, comparing those presenting an SVR (SVRs), nonresponders (NRs), and relapsers (RELs). Among the intent-to-treat patients, an end-of-treatment virological response was achieved in 69 % of the sample as a whole and in 52 % of the SVRs. We found that being an SVR was significantly associated with mild fibrosis (p = 0.04) and with undetectable HCV RNA at weeks 12 and 24 of treatment (p < 0.0001). Comparing the SVR and REL groups, we observed that being older than 40 was significantly associated with being a REL (p = 0.04). Being an NR was found to be associated with severe fibrosis and moderate inflammatory infiltrates (portal or periportal). In the polytomous logistic regression, no independent factors were associated with the REL group when compared with the SVR group. We conclude that RELs and NRs differ in comparison with SVRs. The RELs accounted for 17% of the sample. The HCV RNA test results at weeks 12 and 24 of treatment, although independent predictors of non-response (OR: 4.8 and 8.2, respectively), did not differ between SVRs and RELs.