Acute Exercise Decreases Trb3 Protein Levels In The Hypothalamus Of Obese Rats.

To evaluate the effects of acute exercise on the TRB3 protein levels and interaction between TRB3/Akt proteins in the hypothalamus of obese rats. In addition, we evaluated the relationship between TRB3 and endoplasmic reticulum stress (ER stress) and verified whether an acute exercise session is able to influence these processes. In the first part of the study, the rats were divided into three groups: control (lean) - fed with a standard rodent chow, DIO - fed with a high fat diet and DIO submitted to a swimming acute exercise protocol (DIO-EXE). In the second part of the study, we used other three groups: control (lean) receiving an intracerebroventricular (i.c.v.) infusion of vehicle, lean receiving an i.c.v. infusion of thapsigargin, and lean receiving an i.c.v infusion of thapsigargin and performing an acute exercise session. Four hours after the exercise session, the food intake was measured and the hypothalamus was dissected and separated for subsequent protein analysis by immunoblotting and Real Time PCR. The acute exercise session reduced the TRB3 protein levels, disrupted the interaction between TRB3/Akt proteins, increased the phosphorylation of Foxo1 and restored the anorexigenic effects of insulin in the hypothalamus of DIO rats. Interestingly, the suppressive effects of acute exercise on TRB3 protein levels may be related, at least in part, to the decrease of ER stress (evaluated though pancreatic ER kinase phosphorylation - pPERK and C/EBP homologous protein - CHOP protein levels) in the hypothalamus. In conclusion, the reduction of hypothalamic TRB3 protein levels mediated by exercise may be associated with the reduction of ER stress. These data provided a new mechanism by which an acute exercise session improves insulin sensitivity in hypothalamus and restores food intake control in obesity.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

[physical Exercise During Pregnancy].

36

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Leucine Supplementation Does Not Affect Protein Turnover And Impairs The Beneficial Effects Of Endurance Training On Glucose Homeostasis In Healthy Mice.

Endurance exercise training as well as leucine supplementation modulates glucose homeostasis and protein turnover in mammals. Here, we analyze whether leucine supplementation alters the effects of endurance exercise on these parameters in healthy mice. Mice were distributed into sedentary (C) and exercise (T) groups. The exercise group performed a 12-week swimming protocol. Half of the C and T mice, designated as the CL and TL groups, were supplemented with leucine (1.5 % dissolved in the drinking water) throughout the experiment. As well known, endurance exercise training reduced body weight and the retroperitoneal fat pad, increased soleus mass, increased VO2max, decreased muscle proteolysis, and ameliorated peripheral insulin sensitivity. Leucine supplementation had no effect on any of these parameters and worsened glucose tolerance in both CL and TL mice. In the soleus muscle of the T group, AS-160(Thr-642) (AKT substrate of 160 kDa) and AMPK(Thr-172) (AMP-Activated Protein Kinase) phosphorylation was increased by exercise in both basal and insulin-stimulated conditions, but it was reduced in TL mice with insulin stimulation compared with the T group. Akt phosphorylation was not affected by exercise but was lower in the CL group compared with the other groups. Leucine supplementation increased mTOR phosphorylation at basal conditions, whereas exercise reduced it in the presence of insulin, despite no alterations in protein synthesis. In trained groups, the total FoxO3a protein content and the mRNA for the specific isoforms E2 and E3 ligases were reduced. In conclusion, leucine supplementation did not potentiate the effects of endurance training on protein turnover, and it also reduced its positive effects on glucose homeostasis.

Exercise Increases Pancreatic β-cell Viability In A Model Of Type 1 Diabetes Through Il-6 Signaling.

Type 1 diabetes (T1D) is provoked by an autoimmune assault against pancreatic β cells. Exercise training enhances β-cell mass in T1D. Here, we investigated how exercise signals β cells in T1D condition. For this, we used several approaches. Wild-type and IL-6 knockout (KO) C57BL/6 mice were exercised. Afterward, islets from control and trained mice were exposed to inflammatory cytokines (IL-1β plus IFN-γ). Islets from control mice and β-cell lines (INS-1E and MIN6) were incubated with serum from control or trained mice or medium obtained from 5-aminoimidazole-4 carboxamide1-β-d-ribofuranoside (AICAR)-treated C2C12 skeletal muscle cells. Subsequently, islets and β cells were exposed to IL-1β plus IFN-γ. Proteins were assessed by immunoblotting, apoptosis was determined by DNA-binding dye propidium iodide fluorescence, and NO(•) was estimated by nitrite. Exercise reduced 25, 75, and 50% of the IL-1β plus IFN-γ-induced iNOS, nitrite, and cleaved caspase-3 content, respectively, in pancreatic islets. Serum from trained mice and medium from AICAR-treated C2C12 cells reduced β-cell death, induced by IL-1β plus IFN-γ treatment, in 15 and 38%, respectively. This effect was lost in samples treated with IL-6 inhibitor or with serum from exercised IL-6 KO mice. In conclusion, muscle contraction signals β-cell survival in T1D through IL-6.-Paula, F. M. M., Leite, N. C., Vanzela, E. C., Kurauti, M. A., Freitas-Dias, R., Carneiro, E. M., Boschero, A. C., and Zoppi, C. C. Exercise increases pancreatic β-cell viability in a model of type 1 diabetes through IL-6 signaling.

Eccentric Exercise Leads To Glial Activation But Not Apoptosis In Mice Spinal Cords.

The aim of this investigation was to evaluate the effects of 3 overtraining (OT) protocols on the glial activation and apoptosis in the spinal cords of mice. Rodents were divided into control (C; sedentary mice), overtrained by downhill running (OTR/down), overtrained by uphill running (OTR/up) and overtrained by running without inclination (OTR). The incremental load test, ambulation test, exhaustive test and functional behavioural assessment were used as performance evaluation parameters. 36 h after the exhaustive test, the dorsal and ventral parts of the lumbar spinal cord (L4-L6) were dissected for subsequent protein analysis by immunoblotting. The OT protocols led to similar responses of some performance parameters. The ventral glial fibrillary acidic protein (GFAP) protein levels were diminished in the OTR/up and OTR compared to CT and OTR/down groups. The ventral ionized calcium binding adaptor molecule 1 (Iba-1), and the dorsal GFAP and Iba-1 protein levels were increased in the OTR/down compared to the other groups. The ratio between the cleaved capase-3/caspase-3 and cleaved caspase-9/caspase-9 measured in the spinal cord were not sensitive to the OT protocols. In summary, the OTR/down activated the glial cells in the motor (i. e. Iba-1) and sensory (i. e. GFAP and Iba-1) neurons without leading to apoptosis.

The Effects Of High Doses Of Nandrolone Decanoate And Exercise On Prostate Microvasculature Of Adult And Older Rats.

The present study aimed to investigate the effects of the interaction between the abusive use of nandrolone decanoate (ND) and physical activity on the prostate structure of adult and older rats. We evaluated whether the use of ND, associated or not with physical exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate. Fifty-six male Sprague-Dawley rats were divided into eight groups. The animals were treated for eight weeks and divided into sedentary and trained groups, with or without ND use. Four groups were sacrificed 48 h after the end of the eight week experiment (adult groups), and four other groups were sacrificed at 300 days of age (older groups). The prostate was collected and processed for stereological and histopathological analysis and for the expression of AQP1 and VEGF by the Western blotting technique. Both ND and physical activity altered the ventral prostate structure of the rats; the AQP1 and VEGF expression increased in young animals subjected to physical exercise. Thus, it was concluded that the use of ND, associated or not with exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate.

Prolongamento da amamentação após o primeiro ano de vida: argumentos das mães

This paper aims to identify and analyze the reasons pointed by mothers to prolong breastfeeding beyond the first year of the child s life. The study involved 40 mothers whose children were treated in the Preventive Program of Research and Dental Treatment Center for Special Patients - Dental School of Piracicaba - UNICAMP. The group consisted of mothers who prolonged the breastfeeding beyond the baby s first year of life. All mothers were surveyed by a researcher using a specific questionnaire. In order to avoid information loss, the interviews were taped, then transcripted. Results showed that the main cause of the extended breastfeeding was maternal pleasure. It was also observed that the mother and infant attachment favors prolonged breastfeeding occurrence. Further studies should be carried out for more accurate functional analyses of variable that lead to extend breastfeeding or to wean.

Influência da atividade física na qualidade de vida e auto-imagem de mulheres incontinentes

Our aim was to verify the influence of a physical activities proposal in the quality of life and self image of incontinent women. This study was comparative and exploratory and was developed in 16 weeks. Thirty-seven women with and without urinary incontinence (IU) participated in the study. After the study, significant improvement in general health perception (p < 0.001), UI impact (p = 0.035), physical limitations (p = 0.015), personal relations, (p = 0.048), sleep and disposition (p = 0.012) and concerned with the gravity measurements (p = 0.011) was observed. Concerning self image, alterations in appearance were not observed; however, concerning body satisfaction, the women felt less satisfied with their bodies (p = 0.007). There was a reduction in the number of regions where they felt pain (p = 0.0003) and that they did not like (p = 0.0017). In conclusion, the Physical Education professionals using a systematized and integrated physical activities program can lead the women with IU to significant improvement in the perception of their quality of life and health concerning their self image with improvement of the IU symptoms and reduction of frequency and amount of urinary loss.

Adaptação de protocolos invasivos e não invasivos para avaliações aeróbias e anaeróbias específicas ao basquetebol feminino

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Is Misión Milagro an effective program to prevent blindness in Latin America?

397

Efeitos de diferentes protocolos de treinamento físico sobre o controle autonômico e cardiorrespiratório em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptações musculares ao treinamento de força com sobrecargas excentricas

Universidade Estadual de Campinas . Faculdade de Educação Física