953 resultados para Single crystals
Resumo:
The Bi2Sr2CaCu20g single crystal with a superconducting transition temperature equal to 90 ± 2 K was prepared. The irreversibility line of the single crystal for a mgnetic field direction along the c-axis and T* in the ab-plane was determined. The reduced temperature (l - T ) is proportional to H 1.1 for fields below 004 T and proportional to HO.09 for fields above 0.4 T. The zero temperature upper critical field Hc2(0) and coherence length ~ (0) were determined from the magnetization meaurements to be H-lC2=35.9T , H//C2=31.2T, ~c(0)=35.0 A, and ~ab(0)=32.5A,and from the magnetoresistance measurements to be H-lc2 = 134.6T , H//C2=55.5T '~c(0)=38.1 A, and ~ab(0)=2404 A for both directions of the applied magnetic field. The results obtained for Hc2(0) and ~(O) are not reliable due to the rounding that the single crystal exhibits in the magnetization and magnetoresistance curves. The magnetization relaxation of the single crystal was investigated, and was found to be logarithmic in time, and the relaxation rate increases with temperature up to 50 -60 K, then decreases at higher temperatures.
Resumo:
he phenomenon of single beam mirage effect, otherwise known as photothermal deflection (PTD) effect using a He–Ne laser beam has been employed to detect phase transitions in some liquid crystals. It has been observed that anomalous changes in amplitude occur in the PTD signal level near the transition temperature. The experimental details and the results of measurements made in liquid crystals E8, M21 and M24 are given in this paper.
Resumo:
Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.
Resumo:
A single habit parameterization for the shortwave optical properties of cirrus is presented. The parameterization utilizes a hollow particle geometry, with stepped internal cavities as identified in laboratory and field studies. This particular habit was chosen as both experimental and theoretical results show that the particle exhibits lower asymmetry parameters when compared to solid crystals of the same aspect ratio. The aspect ratio of the particle was varied as a function of maximum dimension, D, in order to adhere to the same physical relationships assumed in the microphysical scheme in a configuration of the Met Office atmosphere-only global model, concerning particle mass, size and effective density. Single scattering properties were then computed using T-Matrix, Ray Tracing with Diffraction on Facets (RTDF) and Ray Tracing (RT) for small, medium, and large size parameters respectively. The scattering properties were integrated over 28 particle size distributions as used in the microphysical scheme. The fits were then parameterized as simple functions of Ice Water Content (IWC) for 6 shortwave bands. The parameterization was implemented into the GA6 configuration of the Met Office Unified Model along with the current operational long-wave parameterization. The GA6 configuration is used to simulate the annual twenty-year short-wave (SW) fluxes at top-of-atmosphere (TOA) and also the temperature and humidity structure of the atmosphere. The parameterization presented here is compared against the current operational model and a more recent habit mixture model.
Resumo:
We report a single-step chemical synthesis of iron oxide hollow nanospheres with 9.3 nm in diameter. The sample presents a narrow particle diameter distribution and chemical homogeneity. The hollow nature of the particles is confirmed by HRTEM and HAADF STEM analysis. Electron and x-ray diffraction show that the outer material component is constituted by 2 nm ferrite crystals. Mossbauer data provide further evidence for the formation of iron oxide with high structural disorder, magnetically ordered at 4.2 K and superparamagnetism at room temperature. An unusual magnetic behavior under an applied field is reported, which can be explained by the large fraction of atoms existing at both inner and outer surfaces.
Resumo:
The spectral decomposition analysis was applied to the optical absorption spectra of green and colorless beryl crystals from the Brazilian Eastern Pegmatitic province in the natural state, Submitted to heat treatment and irradiated with UV light The attributions of the lines were made taking into account highly accurate quantum mechanical calculations The deconvolution of the green beryl spectra revealed four lines, two of them around 12,000 cm(-1) (1 5eV) and two of them around 34,000 cm(-1) (4.2 eV) attributed to Fe(2+) and Fe(3+), respectively The deconvolution of the colorless beryl spectra without any treatment, after heating and for the same heat treatment followed by UV light irradiation revealed five lines The analysis of ratio relations showed that the lines at 36,400 cm(-1) (4.5 eV) and 41,400 cm(-1) (5 1 eV) belongs to a single defect attributed to a silicon dangling bond defect (=Si). Discussions and comparison with reported defects in quartz have supported the allocation of the lines at 61,000 cm(-1) (7.6 eV) and 43,800 cm(-1) (5 4 eV) to diamagnetic oxygen vacancy defect ( Si-Si ) and unrelaxed ( Si Si ) defect, respectively Finally, the line at 39.100 cm(-1) (4.8 eV), quite polarized along the c-axis, was attributed to a (Fe(2+) OH(-)) defect in the structural channels (C) 2009 Elsevier B V All rights reserved
Resumo:
For the first time, crystals of suitable size for X-ray diffractometry structure determination (Dian important anti-HI V drug were prepared under solvothermal conditions. In this study, the crystal structure of didanosine (2`,3`-dideoxyinosine, ddI) in the form of a hydrate was determined using single-crystal X-ray diffractometry. Powder X-ray diffraction analysis revealed that the solid-state phase of the drug incorporated into pharmaceutical solid dosage forms is isostructural to the solvothermally prepared ddI material, even though they do not exhibit an identical chemical composition due to different water fractions occupying hydrophobic channels formed within the crystal lattice. Two ddI conformers are present in the structure, in agreement with a previous structure elucidation attempt. Concerning the keto enol equilibrium of ddI, our crystal data and vibrational characterizations by Fourier transform infrared (FTIR) and FT-Raman spectroscopy techniques were conclusive to state that both conformers exist in the keto form, contrary to solid-state NMR spectroscopic assignments that suggested ddI molecules occur as enol tautomers. In addition, characterizations by thermal (differential scanning calorimetry) and spectroscopic techniques allowed us to understand the structural similarities and the differences related to the hydration pattern of the nonstoichiometric hydrates.
Resumo:
The holographic imaging of rigid objects with diode lasers emitting in many wavelengths in a sillenite Bi12TiO20 photorefractive crystal is both theoretically an experimentally investigated. It is shown that, due to the multi-wavelength emission and the typically large free spectral range of this light source, contour fringes appear on the holographic image corresponding to the surface relief, even in single-exposure recordings. The influence of the number of emitted modes on the fringe width is analysed, and the possible applications of the contour fringes in the field of optical metrology are pointed out.
Resumo:
We studied the use of multiwavelength diode lasers for surface profilometry through holographic recording in sillenite Bi(12)TiO(20) crystals. When such lasers are used, the holographic image from single-exposure recordings appears covered with interference fringes providing information on the surface relief of the object. By taking advantage of the narrow interference fringes due to the multiwavelength emission of the laser, we obtained interferograms by holographic recording with two reference beams, which improves the surface analysis by visual inspection and enhances the profilometry sensitivity. (c) 2005 Optical Society of America.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Barium praseodymium tungstate (Ba1-xPr2x/3)WO4 crystals with (x = 0, 0.01, and 0.02) were prepared by the coprecipitation method. These crystals were structurally characterized by X-ray diffraction (XRD), Rietveld refinements, Fourier-transform Raman (FT-Raman) and Fourier-transform infrared (FT-IR) spectroscopies. The shape and size of these crystals were observed by field emission scanning electron microcopy (FE-SEM). Their optical properties were investigated by ultraviolet visible (UV-vis) absorption and photoluminescence (PL) measurements. Moreover, we have studied the photocatalytic (PC) activity of crystals for degradation of rhodamine B (RhB) dye. XRD patterns, Rietveld refinements data, FT-Raman and FT-IR spectroscopies indicate that all crystals exhibit a tetragonal structure without deleterious phases. FT-Raman spectra exhibited 13 Raman-active modes in a range from 50 to 1000 cm(-1), while FT-IR spectra have 8 infrared active modes in a range from 200 to 1050 cm(-1). FE-SEM images showed different shapes (bonbon-, spindle-, rice-and flake-like) as well as a reduction in the crystal size with an increase in Pr3+ ions. A possible growth process was proposed for these crystals. UV-vis absorption measurements revealed a decrease in optical band gap values with an increase of Pr3+ into the matrix. An intense green PL emission was noted for (Ba1-xPr2x/3)WO4 crystals (x = 0), while crystals with (x = 0.01 and 0.02) produced a reduction in the wide band PL emission and the narrow band PL emission which is related to f-f transitions from Pr3+ ions. High photocatalytic efficiency was verified for the bonbon-like BaWO4 crystals as a catalyst in the degradation of the RhB dye after 25 min under UV-light. Finally, we discuss possible mechanisms for PL and PC properties of these crystals.
Resumo:
Calcium tantalite (CaTa2O6) single crystal fibers were obtained by the laser-heated pedestal growth method (LHPG). At room temperature, this material can present three polymorphic modifications. The rapid crystallization inherent to the LHPG method produced samples within the Pm3 space group, with some chemical disorder. In order to check for polymorphic-induced transformations, the CaTa2O6 fibers have been submitted to different thermal treatments and investigated by micro-Raman spectroscopy. For short annealing times (15 min) at 1200 °C, the cubic modification was maintained, though with an improved crystalline quality, as evidenced by the enhanced inelastic scattered intensity (by ca. 250%) and narrowing of Raman bands. The polarized Raman spectra respected very well the predicted symmetries and the selection rules for this cubic modification. On the other hand, long annealing times (24 h) at 1200 °C led to a complete (irreversible) polymorphic transformation. The Raman bands became still more intense (ca. 15 times larger than for the as-grown fibers), narrower, and several new modes appeared. Also, the spectra became unpolarized, demonstrating a polycrystalline nature of the transformed crystals. The observed Raman modes could be fully assigned to an orthorhombic modification of CaTa2O6 belonging to the Pnma space group.
Resumo:
The scope of my research project is to produce and characterize new crystalline forms of organic compounds, focusing the attention on co-crystals and then transferring these notions on APIs to produce co-crystals of potential interest in the pharmaceutical field. In the first part of this work co-crystallization experiments were performed using as building blocks the family of aliphatic dicarboxylic acids HOOC-(CH2)n-COOH, with n= 2-8. This class of compounds has always been an object of study because it is characterized by an interesting phenomenon of alternation of melting points: the acids with an even number of carbon atoms show a melting point higher than those with an odd one. The acids were co-crystallized with four dipyridyl molecules (formed by two pyridine rings with a different number of bridging carbon atoms) through the formation of intermolecular interactions N•••(H)O. The bases used were: 4,4’-bipyridine (BPY), 1,2-bis(4-pyridyl)ethane (BPA), 1,2-(di-4-pyridyl)ethylene (BPE) and 1,2-bis(4-pyridyl)propane (BPP). The co-crystals obtained by solution synthesis were characterized by different solid-state techniques to determine the structure and to see how the melting points in co-crystals change. In the second part of this study we tried to obtain new crystal forms of compounds of pharmaceutical interest. The APIs studied are: O-desmethylvenlafaxine, Lidocaine, Nalidixic Acid and Sulfadiazine. Each API was subjected to Polymorph Screening and Salt/Co-crystal Screening experiments to identify new crystal forms characterized by different properties. In a typical Salt/Co-crystal Screening the sample was made to react with a co-former (solid or liquid) through different methods: crystallization by solution, grinding, kneading and solid-gas reactions. The new crystal forms obtained were characterized by different solid state techniques (X-ray single crystal diffraction, X-ray powder diffraction, Differential Scanning Calorimetry, Thermogravimetric Analysis, Evolved gas analysis, FT-IR – ATR, Solid State N.M.R).