820 resultados para NIS mRNA poly(A) tail
Resumo:
Four aliphatic thermoplastic poly(ester-urethane)s (PEUs) with similar molecular weights but varying polyesters molecular weight (534-1488 g/mol) were prepared from polyester diols, obtained by melt condensation of Azelaic acid and 1,9-Nonanediol, and 1,7-heptamethylene di-isocyanate (HPMDI) all sourced from vegetable oil feedstock. The thermal, and mechanical properties, and crystal structure of PEUs were investigated using DSC, TGA, DMA, tensile analysis and WAXD. For sufficiently long polyester chain, WAXD data indicated no hydrogen bonds polyethylene (PE)-like crystalline packing and for short polyester chains, small crystal domains with significant H-bonded polyamide (PA)-like packing. Crystallinity decreased with decreasing polyester molecular weights. The polymorphism of PEUs and consequently their melting characteristics were found to be largely controlled by polyester segment length. TGA of the PEUs indicated improved thermal stability with decreasing polyester chain length, suggesting a stabilization effect by urethane groups. Mechanical properties investigated by DMA and tensile analysis were found to scale predictably with the overall crystallinity of PEUs. (C) 2012 Elsevier Ltd. All rights reserved.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Langmuir films have been fabricated from poly[(2-methoxy-5-n-hexyloxy)-p-phenylenevinylene] (OC1OC6-PPV). The stability and the area per monomer for condensed films indicate the formation of true monolayers with a very small extent of aggregation, which is unusual for polymer films. This is attributed to the linearity of the alkyl side chain. The Y-type Langmuir-Blodgett (LB) films produced from Langmuir films of OC1OC6-PPV have distinctive features compared to those of cast films, probably due to the organization in the LB films whereas the molecules are randomly oriented in cast films. Infrared absorption spectra recorded for both transmission and reflection modes indicate that OC1OC6-PPV molecules are anchored to the substrate by the lateral groups. This is confirmed by the Raman spectrum, in which a distortion of the vinylene group was observed, and by surface enhanced fluorescence (SEF) on an LB monolayer deposited onto Ag nanoparticles. The more homogeneous nature of the LB films in comparison with the case of cast films was demonstrated by optical microscopy and fluorescence measurements where the emission spectra were essentially the same for different regions of an LB film but showed dispersion in cast films. The LB films also displayed reversible photoconductivity.
Resumo:
Blend films of poly (o-ethoxyaniline) (POEA) and collagen were fabricated by casting under optimized conditions and characterized by Raman scattering and UV-vis absorption spectroscopies. The UV-vis spectra showed that the addition of collagen in the aqueous solution of POEA promotes a dedoping of the POEA. This effect was also observed for the blend films as supported by Raman scattering and a mechanism for the chemical interaction between POEA-collagen is proposed. The influences of different percentage of collagen as well as the pH of stock solutions during the fabrication process of the blend films were also investigated. It was found that the preparation method plays an important role in the flexibility and freestanding properties of the films. Complementary, the surface morphology was studied by atomic force microscopy and the conductivity by dc measurements. (C) 2003 Elsevier Ltd. All rights reserved.
Resumo:
Poly(styrene-co-methyl methacrylate) (PS-PMMA) ionomers with several degrees of sulfonation were synthesized and characterized by infrared, UV-vis, and NMR spectroscopies, elemental analysis, and differential scanning calorimetry (DSC). Stable Langmuir films could be produced with PS-PMMA with 3 and 6 mol % of sulfonation, while PS-PMMA 8% exhibited material loss to the water subphase, probably due to its higher solubility. Surface pressure and surface potential isotherms with PS-PMMA 3% spread onto salt-containing subphases pointed to a film behavior characteristic of the polyelectrolyte effect, where charge repulsion governs the film properties. The Langmuir-Blodgett films of this ionomer were successfully transferred onto various substrates, as confirmed by UV-vis and FTIR spectroscopies. Using cycling voltammetry, we show that LB films from PS-PMMA 3% can be applied in selective sensing of dopamine, even in the presence of interferents such as ascorbic acid.
Resumo:
A PPV derivative, poly(2-methoxy,5-(n-octadecyl)-p-phenylenevinylene) (OC1OC18-PPV), has been synthesized via the Gilch route and used to fabricate Langmuir and Langmuir-Blodgett (LB) films. True monomolecular films were formed at the air/water interface, which were successfully transferred onto different types of substrate. Using UV-visible absorption, FTIR, fluorescence and Raman scattering spectroscopies we observed that the polymer molecules were randomly distributed in the LB film, with no detectable anisotropy. This is in contrast to the anisotropic LB films of a previously reported PPV derivative, poly(2-methoxy-5-n-hexyloxy)-p-phenylenevinylene (OC1OC6-PPV), which is surprising because the longer chain of OC1OC18-PPV investigated here was expected to lead to more ordered films. As a consequence of the lack of order, LB films of OC1OC18-PPV exhibit lower photoconductivity and require higher operating voltage in a polymer light-emitting diode (PLED) in comparison with LB films of OC1OC6-PPV. This result confirms the importance of molecular organization in the LB film to obtain efficient PLEDs. (c) 2005 Elsevier Ltd. All rights reserved.
Resumo:
The synthesis of a poly(azo)urethane by fixing CO2 in bis-epoxide followed by a polymerization reaction with an azodiamine is presented. Since isocyanate is not used in the process, it is termed clean method and the polymers obtained are named NIPUs (non-isocyanate polyurethanes). Langmuir films were formed at the air-water interface and were characterized by surface pressure vs mean molecular area per met unit (Pi-A) isotherms. The Langmuir monolayers were further studied by running stability tests and cycles of compression/expansion (possible hysteresis) and by varying the compression speed of the monolayer formation, the subphase temperature, and the solvents used to prepare the spreading polymer solutions. The Langmuir-Blodgett (LB) technique was used to fabricate ultrathin films of a particular polymer (PAzoU). It is possible to grow homogeneous LB films of up to 15 layers as monitored using UV-vis absorption spectroscopy. Higher number of layers can be deposited when PAzoU is mixed with stearic acid, producing mixed LB films. Fourier transform infrared (FTIR) absorption spectroscopy and Raman scattering showed that the materials do not interact chemically in the mixed LB films. The atomic force microscopy (AFM) and micro-Raman technique (optical microscopy coupled to Raman spectrograph) revealed that mixed LB films present a phase separation distinguishable at micrometer or nanometer scale. Finally, mixed and neat LB films were successfully characterized using impedance spectroscopy at different temperatures, a property that may lead to future application as temperature sensors. Principal component analysis (PCA) was used to correlate the data.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Low frequency admittance measurements are used to determine the density of interface states in metal-insulator-semiconductor diodes based on the unintentionally doped, p-type semiconductor poly(3-hexylthiophene). After vacuum annealing at 90 degrees C, interface hole trapping states are shown to be distributed in energy with their density decreasing approximately linearly from similar to 20x10(10) to 5x10(10) cm(-2) eV(-1) over an energy range extending from 0.05 to 0.25 eV above the bulk Fermi level. (c) 2008 American Institute of Physics.
Resumo:
Chemical sensors made from nanostructured films of poly(o-ethoxyaniline) POEA and poly(sodium 4-styrene sulfonate) PSS are produced and used to detect and distinguish 4 chemicals in solution at 20 mM, including sucrose, NaCl, HCl, and caffeine. These substances are used in order to mimic the 4 basic tastes recognized by humans, namely sweet, salty, sour, and bitter, respectively. The sensors are produced by the deposition of POEA/PSS films at the top of interdigitated microelectrodes via the layer-by-layer technique, using POEA solutions containing different dopant acids. Besides the different characteristics of the POEA/PSS films investigated by UV-Vis and Raman spectroscopies, and by atomic force microscopy.. it is observed that their electrical response to the different chemicals in liquid media is very fast, in the order of seconds, systematical, reproducible, and extremely dependent on the type of acid used for film fabrication. The responses of the as-prepared sensors are reproducible and repetitive after many cycles of operation. Furthermore, the use of an "electronic tongue" composed by an array of these sensors and principal component analysis as pattern recognition tool allows one to reasonably distinguish test solutions according to their chemical composition. (c) 2007 Published by Elsevier B.V.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The human ZC3H14 gene encodes an evolutionarily conserved Cys(3)His zinc finger protein that binds specifically to polyadenosine RNA and is thus postulated to modulate post-transcriptional gene expression. Expressed sequence tag (EST) data predicts multiple splice variants of both human and mouse ZC3H14. Analysis of ZC3H14 expression in both human cell lines and mouse tissues confirms the presence of multiple alternatively spliced transcripts. Although all of these transcripts encode protein isoforms that contain the conserved C-terminal zinc finger domain, suggesting that they could all bind to polyadenosine RNA, they differ in other functionally important domains. Most of the alternative transcripts encode closely related proteins (termed isoforms 1, 2. 3, and 3short) that differ primarily in the inclusion of three small exons, 9, 10, and 11, resulting in predicted protein isoforms ranging from 82 to 64 kDa. Each of these closely related isoforms contains predicted classical nuclear localization signals (cNLS) within exons 7 and 11. Consistent with the presence of these putative nuclear targeting signals, these ZC3H14 isoforms are all localized to the nucleus. In contrast, an additional transcript encodes a smaller protein (34 kDa) with an alternative first exon (isoform, 4). Consistent with the absence of the predicted cNLS motifs located in exons 7 and 11, ZC3H14 isoform 4 is localized to the cytoplasm. Both EST data and experimental data suggest that this variant is enriched in testes and brain. Using an antibody that detects endogenous ZC3H14 isoforms 1-3 reveals localization of these isoforms to nuclear speckles. These speckles co-localize with the splicing factor, SC35, suggesting a role for nuclear ZC3H14 in mRNA processing. Taken together, these results demonstrate that multiple transcripts encoding several ZC3H14 isoforms exist in vivo. Both nuclear and cytoplasmic ZC3H14 isoforms could have distinct effects on gene expression mediated by the common Cys(3)His zinc finger polyadenosine RNA binding domain. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
With the objective of obtaining slow-acting isoniazid derivatives, of potential use as chemoprophylactics or chemotherapeutics in tuberculosis, the micelle-forming copolymer of poly(ethylene glycol)-poly(aspartic acid) prodrug with isoniazid was synthesized. The derivative obtained was found to be active in Mycobacterium Il(tuberculosis culture, with a minimal inhibitory concentration (MIC) 5.6 times lower than that of the tuberculostatic drug.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Augmented glucose-stimulated insulin secretion (GSIS) is an adaptive mechanism exhibited by pancreatic islets from insulin-resistant animal models. Gap junction proteins have been proposed to contribute to islet function. As such, we investigated the expression of connexin 36 (Cx36), connexin 43 (Cx43), and the glucose transporter Glut2 at mRNA and protein levels in pancreatic islets of dexamethasone (DEX)-induced insulin-resistant rats. Study rats received daily injections of DEX (1 mg/kg body mass, i.p.) for 5 days, whereas control rats (CTL) received saline solution. DEX rats exhibited peripheral insulin resistance, as indicated by the significant postabsorptive insulin levels and by the constant rate for glucose disappearance (K-ITT). GSIS was significantly higher in DEX islets (1.8-fold in 16.7 mmol/L glucose vs. CTL, p < 0.05). A significant increase of 2.25-fold in islet area was observed in DEX vs. CTL islets (p < 0.05). Cx36 mRNA expression was significantly augmented, Cx43 diminished, and Glut2 mRNA was unaltered in islets of DEX vs. CTL (p < 0.05). Cx36 protein expression was 1.6-fold higher than that of CTL islets (p < 0.05). Glut2 protein expression was unaltered and Cx43 was not detected at the protein level. We conclude that DEX-induced insulin resistance is accompanied by increased GSIS and this may be associated with increase of Cx36 protein expression.