Expression cloning of dSR-CI, a class C macrophage-specific scavenger receptor from Drosophila melanogaster.

Mammalian class A macrophage-specific scavenger receptors (SR-A) exhibit unusually broad binding specificity for a wide variety of polyanionic ligands. The properties of these receptors suggest that they may be involved in atherosclerosis and host defense. We have previously observed a similar receptor activity in Drosophila melanogaster embryonic macrophages and in the Drosophila macrophage-like Schneider L2 cell line. Expression cloning was used to isolate from L2 cells a cDNA that encodes a third class (class C) of scavenger receptor, Drosophila SR-CI (dSR-CI). dSR-CI expression was restricted to macrophages/hemocytes during embryonic development. When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation. Although the broad polyanionic ligand-binding specificity of dSR-CI was similar to that of SR-A, their predicted protein sequences are not similar. dSR-CI is a 609-residue type I integral membrane protein containing several well-known sequence motifs, including two complement control protein (CCP) domains and somatomedin B, MAM, and mucin-like domains. Macrophage scavenger receptors apparently mediate important, well-conserved functions and may be pattern-recognition receptors that arose early in the evolution of host-defense mechanisms. Genetic and physiologic analysis of dSR-CI function in Drosophila should provide further insights into the roles played by scavenger receptors in host defense and development.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Microenvironment and microvascular wall modulate cancer cell progression

Tumour progression is a complex process that frequently brings to cancer metastasis, the first cause of poor prognosis of cancer affected patients. Metastasis are generated by cells escaped from a primary mass and able to enter in the circulation, survive and proliferate in a new, distant site of the organism. To reach all these goal, many different phenomena had occur within both the cancer cells and the surrounding microenvironment. In the first part of this thesis, the focus was pointed on the metastatic potential of a leiomyosarcoma cell model. The studied cancer cells demonstrated a strong invasive capacity of the ECM in vitro, principally by production of matrix metalloproteinases 2 and 9, and robust pro-angiogenic activity in the chick CAM model, that facilitate its dissemination through same chick embryo internal organs. This study, with the title “MMPs and angiogenesis affect the metastatic potential of a human vulvar leiomyosarcoma cell line”, is presented in the published form. In the second part of this work, the emphasis was given to the microvascular element of the tumour microenvironment and specifically to the perivascular pericytes. These are intriguing cells due to their uncertain involvement in the biology of cancer. It is not clear how pericytes change within the tumour microenvironment and which is their contribute during the tumour dissemination. After the characterization of the chosen pericytic cell model, an in vitro study of the interaction between pericytes and different cancer cell lines where performed. Indirect and direct cell-cell interaction as well as movement of cancer cells in presence of pericytes conditioned media was analysed, in order to investigate the reciprocal influence of pericytes and tumour cells in the context of cancer progression.

Dissecting the signaling mechanisms of IL-7-mediated autophagy regulation in T-cell acute lymphoblastic leukemia

Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014

Polo-like kinase 4 controls centriole duplication but does not directly regulate cytokinesis

Centrioles organize the centrosome, and accurate control of their number is critical for the maintenance of genomic integrity. Centrioles duplicate once per cell cycle, and duplication is coordinated by Polo-like kinase 4 (Plk4). We previously demonstrated that Plk4 accumulation is autoregulated by its own kinase activity. However, loss of heterozygosity of Plk4 in mouse embryonic fibroblasts has been proposed to cause cytokinesis failure as a primary event, leading to centrosome amplification and gross chromosomal abnormalities. Using targeted gene disruption, we show that human epithelial cells with one inactivated Plk4 allele undergo neither cytokinesis failure nor increase in centrosome amplification. Plk4 is shown to localize exclusively at the centrosome, with none in the spindle midbody. Substantial depletion of Plk4 by small interfering RNA leads to loss of centrioles and subsequent spindle defects that lead to a modest increase in the rate of cytokinesis failure. Therefore, Plk4 is a centriole-localized kinase that does not directly regulate cytokinesis.

The Human genetic mutant cell repository /

Description based on: 7th ed. (1980)

Catalog of cell lines.

Vols. for 1982-1985 consist of data from NIGMS human genetic mutant cell repository sponsored by the National Institute of General Medical Sciences, and from NIA aging cell repository sponsored by the National Institute on Aging. Repositories located at the Institute for Medical Research, Camden, N.J.; for 1986/1987- consist of data from NIGMS human genetic mutant cell repository located at Coriell Institute for Medical Research.

Method for generation of homogeneous multicellular tumor spheroids applicable to a wide variety of cell types

Multicellular tumor spheroids (MCTS) are used as organotypic models of normal and solid tumor tissue. Traditional techniques for generating MCTS, such as growth on nonadherent surfaces, in suspension, or on scaffolds, have a number of drawbacks, including the need for manual selection to achieve a homogeneous population and the use of nonphysiological matrix compounds. In this study we describe a mild method for the generation of MCTS, in which individual spheroids form in hanging drops suspended from a microtiter plate. The method has been successfully applied to a broad range of cell lines and shows nearly 100% efficiency (i.e., one spheroid per drop). Using the hepatoma cell line, HepG2, the hanging drop method generated well-rounded MCTS with a narrow size distribution (coefficient of variation [CV] 10% to 15%, compared with 40% to 60% for growth on nonadherent surfaces). Structural analysis of HepG2 and a mammary gland adenocarcinoma cell line, MCF-7, composed spheroids, revealed highly organized, three-dimensional, tissue-like structures with an extensive extracellular matrix. The hanging drop method represents an attractive alternative for MCTS production, because it is mild, can be applied to a wide variety of cell lines, and can produce spheroids of a homogeneous size without the need for sieving or manual selection. The method has applications for basic studies of physiology and metabolism, tumor biology, toxicology, cellular organization, and the development of bioartificial tissue. (C) 2003 Wiley Periodicals, Inc.

Hodgkin's lymphoma cell lines express a fusion protein encoded by intergenically spliced mRNA for the multilectin receptor DEC-205 (CD205) and a novel C-type lectin receptor DCL-1

Classic Hodgkin's lymphoma (HL) tissue contains a small population of morphologically distinct malignant cells called Hodgkin and Reed-Sternberg (HRS) cells, associated with the development of HL. Using 3'-rapid amplification of cDNA ends ( RACE) we identified an alternative mRNA for the DEC-205 multilectin receptor in the HRS cell line L428. Sequence analysis revealed that the mRNA encodes a fusion protein between DEC-205 and a novel C-type lectin DCL-1. Although the 7.5-kb DEC-205 and 4.2-kb DCL-1 mRNA were expressed independently in myeloid and B lymphoid cell lines, the DEC-205/DCL-1 fusion mRNA (9.5 kb) predominated in the HRS cell lines ( L428, KM-H2, and HDLM-2). The DEC-205 and DCL-1 genes comprising 35 and 6 exons, respectively, are juxtaposed on chromosome band 2q24 and separated by only 5.4 kb. We determined the DCL-1 transcription initiation site within the intervening sequence by 5'-RACE, confirming that DCL-1 is an independent gene. Two DEC-205/DCL-1 fusion mRNA variants may result from cotranscription of DEC-205 and DCL-1, followed by splicing DEC-205 exon 35 or 34-35 along with DCL-1 exon 1. The resulting reading frames encode the DEC-205 ectodomain plus the DCL-1 ectodomain, the transmembrane, and the cytoplasmic domain. Using DCL-1 cytoplasmic domain-specific polyclonal and DEC-205 monoclonal antibodies for immunoprecipitation/Western blot analysis, we showed that the fusion mRNA is translated into a DEC-205/DCL-1 fusion protein, expressed in the HRS cell lines. These results imply an unusual transcriptional control mechanism in HRS cells, which cotranscribe an mRNA containing DEC-205 and DCL-1 prior to generating the intergenically spliced mRNA to produce a DEC-205/DCL-1 fusion protein.

Comparative proteomic analysis of GS-NSO murine myeloma cell lines with varying recombinant monoclonal antibody production rate

We have employed an inverse engineering strategy based on quantitative proteome analysis to identify changes in intracellular protein abundance that correlate with increased specific recombinant monoclonal antibody production (qMab) by engineered murine myeloma (NSO) cells. Four homogeneous NSO cell lines differing in qMab were isolated from a pool of primary transfectants. The proteome of each stably transfected cell line was analyzed at mid-exponential growth phase by two-dimensional gel electrophoresis (2D-PAGE) and individual protein spot volume data derived from digitized gel images were compared statistically. To identify changes in protein abundance associated with qMab clatasets were screened for proteins that exhibited either a linear correlation with cell line qMab or a conserved change in abundance specific only to the cell line with highest qMab. Several proteins with altered abundance were identified by mass spectrometry. Proteins exhibiting a significant increase in abundance with increasing qMab included molecular chaperones known to interact directly with nascent immunoglobulins during their folding and assembly (e.g., BiP, endoplasmin, protein disulfide isomerase). 2D-PAGE analysis showed that in all cell lines Mab light chain was more abundant than heavy chain, indicating that this is a likely prerequisite for efficient Mab production. In summary, these data reveal both the adaptive responses and molecular mechanisms enabling mammalian cells in culture to achieve high-level recombinant monoclonal antibody production. (C) 2004 Wiley Periodicals, Inc.

Brca1 inactivation induces p27Kip1-dependent cell cycle arrest and delayed development in the mouse mammary gland

One common characteristic of breast cancers arising in carriers of the predisposition gene BRCA1 is a loss of expression of the CDK inhibitor p27(Kip1) (p27), suggesting that p27 interacts epistatically with BRCA1. To investigate this relationship, we examined expression of p27 in mice expressing a dominant negative allele of Brca1 (MMTV-trBr) in the mammary gland. While these mice rarely develop tumors, they showed a 50% increase in p27 protein and a delay in mammary gland development associated with reduced proliferation. In contrast, on a p27 heterozygote background, MMTV-trBrca1 mice showed an increase in S phase cells, and normal mammary development. p27 was the only protein in the cyclin cyclin-dependent kinase network to show altered expression, suggesting that it may be a central mediator of cell cycle arrest in response to loss of function of BRCA1. Furthermore, in human mammary epithelial MCF7 cells expressing BRCA1-specific RNAi and in the BRCA1-deficient human tumor cell line HCC1937, p27 is elevated at the mRNA level compared to cells expressing wild-type BRCA1. We hypothesize that disruption of BRCA1 induces an increase in p27 that inhibits proliferation. Accordingly, reduction in p27 expression leads to enhancement of cellular proliferation in the absence of BRCA1.

Replication of Heliothis virescens ascovirus in insect cell lines

Ascoviruses (AVs) infect larvae of various insect pests belonging to the family Noctuidae. The result of AV infection in the hosts is cleavage of infected cells into vesicles, a unique feature of AV infection. Since insect cell lines facilitate the study of virus life cycles, attempts were made to analyze Heliothis virescens AV (HvAV3e) infection in several cell lines and compare cell pathology to larval infection. In this study, replication and cytopathological effects of HvAV3e on four different cell lines were investigated. HvAV3e replication was confirmed in three noctuid cell lines from Spodoptera frugiperda (Sf9) and Helicoverpa zea (BCIRL-Hz-AM1 and FB33). However, the virus did not replicate in the non-noctuid insect cell line from Pieris rapae (Pieridae). Despite replication of the virus in the three permissive cell lines, the cytopathological effects of the virus were significantly different from that of larval infection.

Expression of LAG-3 by tumor-infiltrating lymphocytes is coincident with the suppression of latent membrane antigen-specific CD8(+) T-cell function in Hodgkin lymphoma patients

In Hodgkin lymphoma (HL), the malignant Hodgkin Reed-Sternberg (HRS) cells constitute only 0.5% of 10% of the diseased tissue. The surrounding cellular infiltrate is enriched with T cells that are hypothesized to modulate antitumor immunity. We show that a marker of regulatory T cells, LAG-3, is strongly expressed on infiltrating lymphocytes present in proximity to HRS cells. Circulating regulatory T cells (CD4(+) CD25(hi) CD45 ROhi, CD4(+) CTLA4(hi), and CD4(+) LAG-3(hi)) were elevated in HL patients with active disease when compared with remission. Longitudinal profiling of EBV-specific CD8(+) T-cell responses in 94 HL patients revealed a selective loss of interferon-gamma expression by CD8(+) T cells specific for latent membrane proteins 1 and 2 (LMP1/2), irrespective of EBV tissue status. Intratumoral LAG-3 expression was associated with EBV tissue positivity, whereas FOXP3 was linked with neither LAG-3 nor EBV tissue status. The level of LAG-3 and FOXP3 expression on the tumor-infiltrating lymphocytes was coincident with impairment of LMP1/2-specific T-cell function. In vitro pre-exposure of peripheral blood mono-nuclear cells to HRS cell line supernatant significantly increased the expansion of regulatory T cells and suppressed LMP-specific T-cell responses. Deletion of CD4(+) LAG-3(+) T cells enhanced LMP-specific reactivity. These findings indicate a pivotal role for regulatory T cells and LAG-3 in the suppression of EBV-specific cell-mediated immunity in HL.

Heterogeneity of MUC1 expression by human breast carcinoma cell lines in vivo and in vitro

Increased expression of the epithelial mucin MUC1 has been linked to tumor aggressiveness in human breast carcinoma. Recent studies have demonstrated that overexpression of MUC1 interferes with cell-substrate and cell-cell adhesion by masking cell surface integrins and E-cadherin. Additionally, the cytoplasmic tail of MUC1 is involved in signal transduction and interactions with catenins. In the present study, we have examined the in vitro expression of MUC1 mRNA and protein in a panel of 14 human breast cancer cell lines using northern blotting, western blotting, immunocytochemistry, and flow cytometry. Considerable variability of expression was noted not only between cell lines but also within several individual lines. Many cell lines such as BT 20, KPL-1, and T47D expressed abundant MUC1 whilst others such as MDA-MB-231 and MCF-7 showed intermediate expression, and MDA-MB-435 and MDA-MB-453 expressed very low levels. Low levels of MUC1 expression were associated with decreased expression of cytokeratin and increased expression of vimentin. Additionally, 12 of the cell lines were established as xenografts in immunocompromised (SCID) mice, and MUC1 expression in both the primary tumors as well as metastases was assessed immunohistochemically. In general, in vivo expression mirrored in vitro expression, although there was reduced in vivo expression in T47D and ZR-75-1 xenografts. Although we showed no correlation between tumorigenicity or metastasis and MUC1 expression, this study will assist development of experimental models to assess the influence of MUC1 of on breast cancer progression.