Purification and biochemical characterization of a mycelial glucose- and xylose-stimulated beta-glucosidase from the thermophilic fungus Humicola insolens

A mycelial beta-glucosidase from the thermophilic mold Humicola insolens was purified and biochemically characterized. The enzyme showed carbohydrate content of 21% and apparent molecular mass of 94 kDa, as estimated by gel filtration. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis showed a single polypeptide band of 55 kDa, suggesting that the native enzyme was a homodimer. Mass spectrometry analysis showed amino acid sequence similarity with a P-glucosidase from Humicola grisea var. thermoidea, with about 22% coverage. Optima of temperature and pH were 60 degrees C and 6.0-6.5, respectively. The enzyme was stable up to I h at 50 degrees C and showed a half-life of approximately 44 min at 55 degrees C. The beta-glucosidase hydrolyzed cellobiose, lactose, p-nitrophenyl-beta-D-glucopyranoside, p-nitrophenyl-beta-D-fucopyranoside, p-nitrophenyl-beta-D-xylopyranoside, p-nitrophenyl-beta-D-galactopyranoside, o-nitrophenyl-beta-D-galactopyranoside, and salicin. Kinetic studies showed that p-nitrophenyl-beta-D-fucopyranoside and cellobiose were the best enzyme substrates. Enzyme activity was stimulated by glucose or xylose at concentrations up to 400 mM, with maximal stimulatory effect (about 2-fold) around 40 mM. The high catalytic efficiency for the natural substrate, good thermal stability, strong stimulation by glucose or xylose, and tolerance to elevated concentrations of these monosaccharides qualify this enzyme for application in the hydrolysis of cellulosic materials. (C) 2009 Elsevier Ltd. All rights reserved.

Functional and Evolutionary Insights from the Genomes of Three Parasitoid Nasonia Species

We report here genome sequences and comparative analyses of three closely related parasitoid wasps: Nasonia vitripennis, N. giraulti, and N. longicornis. Parasitoids are important regulators of arthropod populations, including major agricultural pests and disease vectors, and Nasonia is an emerging genetic model, particularly for evolutionary and developmental genetics. Key findings include the identification of a functional DNA methylation tool kit; hymenopteran-specific genes including diverse venoms; lateral gene transfers among Pox viruses, Wolbachia, and Nasonia; and the rapid evolution of genes involved in nuclear-mitochondrial interactions that are implicated in speciation. Newly developed genome resources advance Nasonia for genetic research, accelerate mapping and cloning of quantitative trait loci, and will ultimately provide tools and knowledge for further increasing the utility of parasitoids as pest insect-control agents.

Heterologous expression of an Aspergillus niveus xylanase GH11 in Aspergillus nidulans and its characterization and application

A xylanase was cloned from Aspergillus niveus and successfully expressed in Aspergillus nidulans (XAN). The full-length gene consisted of 890 bp and encoded 275 mature amino acids with a calculated mass of 31.3 kDa. The deduced amino acid sequence was highly homologous with the xylanase belonging to family 11 of the glycoside hydrolases. The recombinant protein was purified to electrophoretic homogeneity by anion-exchange chromatography and gel filtration. The optima of pH and temperature for the recombinant enzyme were 5.0 and 65 degrees C, respectively. The thermal stability of the recombinant xylanase was extremely improved by covalent immobilization on glyoxyl agarose with 91.4% of residual activity after 180 min at 60 degrees C, on the other hand, the free xylanase showed a half-life of 9.9 min at the same temperature. Affinity chromatography on Concanavalin A- and Jacalin-agarose columns followed by SDS-PAGE analyses showed that the XAN has O- and N-glycans. XAN promotes hydrolysis of xylan resulting in xylobiose, xylotriose and xylotetraose. Intermediate degradation of xylan resulting in xylo-oligomers is appealing for functional foods as the beneficial effect of oligosaccharides on gastrointestinal micro flora includes preventing proliferation of pathogenic intestinal bacteria and facilitates digestion and absorption of nutrients. (C) 2011 Elsevier Ltd. All rights reserved.

Dermaseptins from Phyllomedusa oreades and Phyllomedusa distincta: Liposomes fusion and/or lysis investigated by fluorescence and atomic force microscopy

Three dermaseptins, DS 01, DD K, and DD L, were compared with respect to their structural features and interactions with liposomes. Circular dichroic spectra at alcohols of different chain lengths revealed that DS 01 has the higher helicogenic potential in hydrophobic media. Binding of DS 01, DD K, and DD L to liposomes induced significant blue shifts of the emission spectra of the single tryptophan located at position 3 of all sequences indicating association of the peptides with bilayers. Kinetics evaluation of atomic force microscopy images evidenced the strong fusogenic activity of DS 01 whereas DD K and DD L showed increased lytic activities. (C) 2007 Elsevier Inc. All rights reserved.

The human sulfotransferase SULT1A1 gene is regulated in a synergistic manner by Sp1 and GA binding protein

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

Temperature effect on the sorption of cholate anions on calcined LDH

Layered Double Hydroxides are a class of materials that can be described as positively charged layers of divalent and trivalent cations in the centre of edge-sharing octahedra. Cholesterol derivatives such as cholic acid are substances that play an important role in the digestion of fat components by the organism. This work presents a study on the intercalation of cholate anions in calcined MgAl-CO(3)-HDL. Isotherm experiments were performed at three different temperatures to evaluate the capacity of anion removal by sorption in the calcined LDH. The plateau was reached in all conditions. Increasing temperature results in decreasing cholate sorption. Characteristic peaks of LDH regenerated with OH(-) anions were observed at lower cholate concentrations. A peak in 2 theta equals to 7.5 degrees and peaks between 15 degrees and 20 degrees are observed. Those peaks are the same as the ones observed in the pure sodium cholate PXRD. At higher cholate concentrations the sorbed solids present PXRD related to an additional layered phase, which is related to intercalation of cholate anions with basal spacing equal to 34.3 angstrom. Thus, the cholate anions are also intercalated with a bilayer molecular arrangement at equilibrium concentrations at the isotherms plateau. (C) 2009 Elsevier Ltd. All rights reserved.

Refolding and purification of the human secreted group IID phospholipase A(2) expressed as inclusion bodies in Escherichia coli

The secreted phospholipases A(2) (sPLA(2)s) are water-soluble enzymes that bind to the surface of both artificial and biological lipid bilayers and hydrolyze the membrane phospholipids. The tissue expression pattern of the human group IID secretory phospholipase A(2) (hsPLA(2)-IID) suggests that the enzyme is involved in the regulation of the immune and inflammatory responses. With an aim to establish an expression system for the hsPLA(2)-IID in Escherichia coli, the DNA-coding sequence for hsPLA(2)-IID was subcloned into the vector pET3a, and expressed as inclusion bodies in E. coli (BL21). A protocol has been developed to refold the recombinant protein in the presence of guanidinium hydrochloride, using a size-exclusion chromatography matrix followed by dilution and dialysis to remove the excess denaturant. After purification by cation-exchange chromatography, far ultraviolet circular dichroism spectra of the recombinant hsPLA(2)-IID indicated protein secondary structure content similar to the homologous human group IIA secretory phospholipase A(2). The refolded recombinant hsPLA(2)-IID demonstrated Ca(2+)-dependent hydrolytic activity, as measuring the release free fatty acid from phospholipid liposomes. This protein expression and purification system may be useful for site-directed mutagenesis experiments of the hsPLA(2)-IID which will advance our understanding of the structure-function relationship and biological effects of the protein. (C) 2009 Elsevier Inc. All rights reserved.

PREDBALB/c: a system for the prediction of peptide binding to H2(d) molecules, a haplotype of the BALB/c mouse

PREDBALB/c is a computational system that predicts peptides binding to the major histocompatibility complex-2 (H2(d)) of the BALB/c mouse, an important laboratory model organism. The predictions include the complete set of H2(d) class I ( H2-K-d, H2-L-d and H2-D-d) and class II (I-E-d and I-A(d)) molecules. The prediction system utilizes quantitative matrices, which were rigorously validated using experimentally determined binders and non-binders and also by in vivo studies using viral proteins. The prediction performance of PREDBALB/c is of very high accuracy. To our knowledge, this is the first online server for the prediction of peptides binding to a complete set of major histocompatibility complex molecules in a model organism (H2(d) haplotype). PREDBALB/c is available at http://antigen.i2r.a-star.edu.sg/predBalbc/.

Seasonal dynamics of a drosophilid (Diptera) assemblage and its potencial as bioindicator in open environments

Drosophila Fallen, 1823 (Diptera, Drosophilidae) is for long a well-established model organism for genetics and evolutionary research. The ecology of these flies, however, has only recently been better studied. Recent papers show that Drosophila assemblies can be used as bioindicators of forested environment degradation. In this work the bioindicator potential of drosophilids was evaluated in a naturally opened environment, a coastal strand-forest (restinga). Data from nine consecutive seasonal collections revealed strong temporal fluctuation pattern of the majority of Drosophila species groups. Drosophila willistoni group was more abundant at autumns, whereas D. cardini and D. tripunctata groups were, respectively, expressive at winters and springs, and D. repleta group at both seasons. The exotic species D. simulans Sturtevant, 1919 (from D. melanogaster group) and Zaprionus indianus Gupta, 1970 were most abundant at summers. Overall, the assemblage structure did not show the same characteristics of forested or urban environments, but was similar to the forests at winters and to cities at summers. This raises the question that this locality may already been under urbanization impact. Also, this can be interpreted as an easily invaded site for exotic species, what might lead to biotic homogenization and therefore can put in check the usage of drosophilid assemblages as bioindicators at open environments.

Disruption of NaS1 sulfate transport function in mice leads to enhanced acetaminophen-induced hepatotoxicity

Sulfate is required for detoxification of xenobiotics such as acetaminophen (APAP), a leading cause of liver failure in humans. The NaS1 sulfate transporter maintains blood sulfate levels sufficiently high for sulforiation reactions to work effectively for drug detoxification. In the present study, we identified two loss-of-function polymorphisms in the human NaS1 gene and showed the Nas1-null mouse to be hypersensitive to APAP hepatotoxicity. APAP treatment led to increased liver damage and decreased hepatic glutathione levels in the hyposulfatemic Nas1-null mice compared with that in normosulfatemic wild-type mice. Analysis of urinary APAP metabolites revealed a significantly lower ratio of APAP-sulfate to APAP-glucuronide in the Nas1-null mice. These results suggest hyposulfatemia increases sensitivity to APAP-induced hepatotoxicity by decreasing the sulfonation capacity to metabolize APAP. In conclusion, the results of this study highlight the importance of plasma sulfate level as a key modulator of acetaminophen metabolism and suggest that individuals with reduced NaS1 sulfate transporter function would be more sensitive to hepatotoxic agents.

Isolation of dopamine D-2 receptor (D2R) promoters in Mugil cephalus

This paper reports the isolation of two putative D2R promoters from grey mullet, one 5' flanking and the other an intronic sequence immediately upstream of the first coding exon. Promoter activity of the intronic sequence was confirmed in vitro through functional analysis using luciferase as reporter gene. The functional characteristics of the region flanking the 5'-UTR is currently under investigation.

Structural shifts of aldehyde dehydrogenase enzymes were instrumental for the early evolution of retinoid-dependent axial patterning in metazoans

Aldehyde dehydrogenases (ALDHs) catabolize toxic aldehydes and process the vitamin A-derived retinaldehyde into retinoic acid (RA), a small diffusible molecule and a pivotal chordate morphogen. In this study, we combine phylogenetic, structural, genomic, and developmental gene expression analyses to examine the evolutionary origins of ALDH substrate preference. Structural modeling reveals that processing of small aldehydes, such as acetaldehyde, by ALDH2, versus large aldehydes, including retinaldehyde, by ALDH1A is associated with small versus large substrate entry channels (SECs), respectively. Moreover, we show that metazoan ALDH1s and ALDH2s are members of a single ALDH1/2 clade and that during evolution, eukaryote ALDH1/2s often switched between large and small SECs after gene duplication, transforming constricted channels into wide opened ones and vice versa. Ancestral sequence reconstructions suggest that during the evolutionary emergence of RA signaling, the ancestral, narrow-channeled metazoan ALDH1/2 gave rise to large ALDH1 channels capable of accommodating bulky aldehydes, such as retinaldehyde, supporting the view that retinoid-dependent signaling arose from ancestral cellular detoxification mechanisms. Our analyses also indicate that, on a more restricted evolutionary scale, ALDH1 duplicates from invertebrate chordates (amphioxus and ascidian tunicates) underwent switches to smaller and narrower SECs. When combined with alterations in gene expression, these switches led to neofunctionalization from ALDH1-like roles in embryonic patterning to systemic, ALDH2-like roles, suggesting functional shifts from signaling to detoxification.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Transfer of Conglomeromonas largomobilis subsp largomobilis to the genus Azospirillum as Azopirillum largomobile comb nov, and elevation of Conglomeromonas largomobilis subsp parooensis to the new type species of Conglomeromonas, Conglomeromonas parooensi

Analysis of the 16S rDNA sequence of Conglomeromonas largomobilis subsp. largomobilis supports a phylogenetic relationship with the species of the genus Azospirillum. This confirms results of previous nucleic acid hybridization studies (FALK, E. C., J. L. JOHNSON, V. D. L. BALDANI, J. DOBEREINER, and N. R. KRIEG. 1986. Int. J. Syst. Bacteriol. 36: 80-85). Conglomeromonas largomobilis subsp. largomobilis was most closely related to the species Azospirillim lipoferum and Azospirillum brasilense but sufficiently distant to warrant separate species status. Conglomeromonas largomobilis subsp. parooensis was more distantly related to the existing species of Azospirillum and represents an isolated subline of descent. On the basis of the phylogenetic evidence a prosposal is made to transfer the subspecies Conglom-eromonas largomobilis subsp. largomobilis to the genus Azospirillum as Azospirillum largomobile comb. nov. and to retain the genus Conglomeromonas by elevating the subspecies C. largomobilis subsp. parooensis to the type species of Conglomeromonas as Conglomeromonas parooensis sp. nov.