998 resultados para Bioblendas poliméricas. Extrusão. Gelatina. Amido


Relevância:

10.00% 10.00%

Publicador:

Resumo:

O amadurecimento induzido por climatização em bananas, é um procedimento que tem sido largamente utilizado. Ele proporciona uma maturação uniforme, já que a fruta apresenta maturação desuniforme em vista da formação dos frutos em pencas com diferentes idades. No entanto, não há para todas as cultivares de banana, estudos específicos em relação ao tempo entre a colheita e a climatização que possa afetar a qualidade dos frutos. Desta forma, com o presente trabalho objetivou-se avaliar mediante as características físicas, químicas e fisiológicas a qualidade da banana - prata climatizada em diferentes dias entre a colheita e a climatização. Foram testados três diferentes dias de climatização sendo 1, 2 e 3 dias após a colheita. Ao final da climatização, os frutos foram armazenados em temperatura ambiente por um período de 5 dias. As análises realizadas foram: perda de massa, coloração da casca, respiração, firmeza, pH, sólidos solúveis, acidez titulável e amido. Frutas climatizadas 1 dia após a colheita apresentaram-se, no 1º dia de armazenamento, com menor perda de massa, mais verdes, com maior liberação de CO2, mais firmes, com menores teores de sólidos solúveis e maior porcentagem de amido, quando comparados àqueles climatizados aos 2 e 3 dias após a colheita. Essa diferença foi reduzida com o decorrer do armazenamento praticamente se igualando os tratamentos ao final do armazenamento.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O objetivo deste trabalho foi avaliar as características físico-químicas, a qualidade nutricional e a suscetibilidade ao esverdeamento pós-colheita de tubérculos de cultivares de batata. Utilizou-se o delineamento experimental de blocos ao acaso, com cinco repetições. Os tratamentos consistiram de 11 cultivares (Ágata, Ambra, Annabelle, Asterix, Atlantic, Cupido, Daisy, Fontane, Innovator, Markies e Voyager). As cultivares Ágata, Ambra, Annabelle, Cupido e Voyager apresentam tubérculos com polpa de menor firmeza (6,82 a 8,25 N) e baixos teores de matéria seca (14,46 a 17,57%), carboidratos (10,97 a 12,51%) e amido (10,21 a 12,26%), adequados para o mercado fresco, a preparação de massas e o uso culinário. Já as cultivares Atlantic, Fontane e Innovator apresentam polpa firme (9,14 a 9,55 N) e elevados teores de matéria seca (19,68 a 21,63%), carboidratos (14,49 a 15,90%) e amido (14,29 a 15,74%), adequados para fritura. As cultivares Asterix e Markies apresentam teores intermediários dessas características e são indicadas para o preparo de massas e fritura. As cultivares Innovator e Markies apresentam melhor qualidade nutricional, com elevados teores de minerais (P, K, Mg, Cu e Mn) e de proteína, enquanto as cultivares Ágata e Ambra apresentam menor qualidade nutricional e proteica. A cultivar Voyager apresenta maior esverdeamento pós-colheita que as cultivares Annabelle, Fontane, Markies, Ambra e Atlantic.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The use of polymer based coatings is a promising approach to reduce the corrosion problem in carbon steel pipes used for the transport of oil and gas in the oil industry. However, conventional polymer coatings offer limited properties, which often cannot meet design requirements for this type of application, particularly in regard to use temperature and wear resistance. Polymer nanocomposites are known to exhibit superior properties and, therefore, offer great potential for this type of application. Nevertheless, the degree of enhancement of a particular property is greatly dependent upon the matrix/nanoparticle material system used, the matrix/nanoparticle interfacial bonding and also the state of dispersion of the nanoparticle in the polymer matrix. The objective of the present research is to develop and characterize polymer based nanocomposites to be used as coatings in metallic pipelines for the transportation of oil and natural gas. Epoxy/SiO2 nanocomposites with nanoparticle contents of 2, 4, and 8 wt % were processed using a high-energy mill. Modifications of the SiO2 nanoparticles‟ surfaces with two different silane agents were carried out and their effect on the material properties were investigated. The state of dispersion of the materials processed was studied using Scanning and Transmission Electron Microscopy (SEM and TEM) micrographs. Thermogravimetric analysis (TG) were also conducted to determine the thermal stability of the nanocomposites. In addition, the processed nanocomposites were characterized by dynamic mechanical analysis (DMA) to investigate the effect of nanoparticles content and silane treatment on the viscoelastic properties and on the glass transition temperature. Finally, wear tests of the pin-on-disc type were carried out to determine the effects of the nanoparticles and the silane treatments studied. According to the results, the addition of SiO2 nanoparticles treated with silane increased the thermal stability, the storage modulus and Tg of the epoxy resin and decreased wear rate. This confirms that the interaction between the nanoparticles and the polymer chains plays a critical role on the properties of the nanocomposites

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Chitin and chitosan are nontoxic, biodegradable and biocompatible polymers produced by renewable natural sources with applications in diverse areas such as: agriculture, textile, pharmaceutical, cosmetics and biomaterials, such as gels, films and other polymeric membranes. Both have attracted greater interest of scientists and researchers as functional polymeric materials. In this context, the objective of this study was to take advantage of the waste of shrimp (Litopenaeus vannamei and Aristeus antennatus) and crabs (Ucides cordatus) from fairs, beach huts and restaurant in Natal/RN for the extraction of chitin and chitosan for the production of membranes by electrospinning process. The extraction was made through demineralization, deproteinization, deodorization and deacetylation. Morphological analyzes (SEM and XRD), Thermal analysis (TG and DTG), Spectroscopy in the Region of the Infrared with Transformed of Fourier (FTIR) analysis Calorimetry Differential Scanning (DSC) and mechanical tests for traction were performed. In (XRD) the semicrystalline structure of chitosan can be verified while the chitin had higher crystallinity. In the thermal analysis showed a dehydration process followed by decomposition, with similar behavior of carbonized material. Chitosan showed temperature of maximum degradation lower than chitin. In the analysis by Differential Scanning Calorimetry (DSC) the curves were coherent to the thermal events of the chitosan membranes. The results obtained with (DD) for chitosan extracted from Litopenaeus vannamei and Aristeus antennatus shrimp were (80.36 and 71.00%) and Ucides cordatus crabs was 74.65%. It can be observed that, with 70:30 solutions (v/v) (TFA/DCM), 60 and 90% CH3COOH, occurred better facilitate the formation of membranes, while 100:00 (v/v) (TFA/DCM) had formation of agglomerates. In relation to the monofilaments diameters of the chitosan membranes, it was noted that the capillary-collector distance of 10 cm and tensions of 25 and 30 kV contributed to the reduction of the diameters of membranes. It was found that the Young s modulus decreases with increasing concentration of chitosan in the membranes. 90% CH3COOH contributed to the increase in the deformation resulting in more flexible material. The membranes with 5% chitosan 70:30 (v/v) (TFA/DCM) had higher tensile strength

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The sector of civil construction is strongly related to the red ceramic industry. This sector uses clay as raw material for manufacturing of various products such as ceramic plates. In this study, two types of clay called clay 1 and clay 2 were collected on deposit in Ielmo Marinho city (RN) and then characterized by thermogravimetric analysis (TG/DTG), differential thermal analysis (DTA), X-ray diffraction (XRD), X-ray fluorescence (XRF), rational analysis and particle size distribution and dilatometric analyses. Ceramic plates were manufactured by uniaxial pressing and by extrusion. The plates obtained by pressing were produced from the four formulations called 1, 2, 3 and 4, which presented, respectively, the following proportions by mass: 66.5% clay 1 and 33.5% clay 2, 50% clay 1 and 50% clay 2, 33.5% clay 1 and 66.5% clay 2, 25% clay 1 and 75% clay 2. After firing at 850, 950 and 1050 °C with heating rate of 10 °C/min and soaking time of 30 minutes, the following technological properties were determined: linear firing shrinkage, water absorption, apparent porosity, apparent specific mass and tensile strength (3 points). The formulation containing 25% clay 1 produced plates with most satisfactory results of water absorption and mechanical resistance, because of that it was chosen for manufacturing plates by extrusion. A single firing cycle was established for these plates, which took place as follow: heating rate of 2 °C/min up to 600 ºC with soaking time of 60 minutes, followed by heating using the same rate up to 1050 ºC with soaking time of 30 minutes. After this cycle, the same technological properties investigated in the plates obtained by pressing were determined. The results indicate (according to NRB 13818/1997) that the plates obtained by pressing from the mixture containing 25 wt% clay 1, after firing at 1050 °C, reach the specifications for semi-porous coating (BIIb). On the other hand, the plates obtained by extrusion were classified as semi-stoneware (group AIIa)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This research presents an approach to the addition of curauá fibers and licuri fibers in a polypropylene resin matrix, such as an alternative proposal to reinforce the polymeric composites. Fiber content of 0 %, 5 %, 10 %, and 20% were analyzed for verification of their mechanical properties comparing them, inclusive with the properties of polypropylene. The grainulated biocomposites had been prepared in an extrusora. The test bodies had been molded by injection and submitted to the mechanical essays uniaxial traction, flexion on three points, impact, in addition to thermal tests (HDT). These biocomposites had been also subjected the essay physicist-chemistry index of fluidity (IF). It was observed that the biocomposites of PP with 20% curauá, obtained bigger increase in the modulus of elasticity and a bigger reduction in the resistance to the impact. In the mechanical behavior, for all the biocomposites, these were increases in values of the limit of drainage and tension of rupture, when tested by uniaxial traction, as they added the fibers. Another important point was the increase of the resistance the flexion. It was also noted that the addition of fibers reduced the thermal degradation of the mixture natural fibers / polypropylene.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Composites based on PEEK + PTFE + CARBON FIBER + Graphite (G_CFRP) has increased application in the top industries, as Aerospace, Aeronautical, Petroleum, Biomedical, Mechanical and Electronics Engineering challenges. A commercially available G_CFRP was warmed up to three different levels of thermal energy to identify the main damage mechanisms and some evidences for their intrinsic transitions. An experimental test rig for systematize a heat flux was developed in this dissertation, based on the Joule Effect. It was built using an isothermal container, an internal heat source and a real-time measurement system for test a sample by time. A standard conical-cylindrical tip was inserted into a soldering iron, commercially available and identified by three different levels of nominal electrical power, 40W (manufacturer A), 40W (manufacturer B), 100W and 150W, selected after screening tests: these power levels for the heat source, after one hour of heating and one hour of cooling in situ, carried out three different zones of degradation in the composite surface. The bench was instrumented with twelve thermocouples, a wattmeter and a video camera. The twelve specimens tested suffered different degradation mechanisms, analyzed by DSC (Differential Scanning Calorimetry) and TG (Thermogravimetry) techniques, Scanning Electron Microscopy (SEM) and Energy-Dispersive X-Rays (EDX) Analysis. Before and after each testing, it was measured the hardness of the sample by HRM (Hardness Rockwell M). Excellent correlations (R2=1) were obtained in the plots of the evaporated area after one hour of heating and one hour of cooling in situ versus (1) the respective power of heat source and (2) the central temperature of the sample. However, as resulting of the differential degradation of G_CFRP and their anisotropy, confirmed by their variable thermal properties, viscoelastic and plastic properties, there were both linear and non-linear behaviour between the temperature field and Rockwell M hardness measured in the radial and circumferential directions of the samples. Some morphological features of the damaged zones are presented and discussed, as, for example, the crazing and skeletonization mechanism of G_CFRP

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The cashew, a fruit from Brazilian Northeast is used to produce juice due to its flavor and vitamin C richness. However, its acceptance is limited due to its astringency. Cajuína is a derivate product appreciated by its characteristic flavor, freshness and lack of astringency, due to tannin removal. Cajuína is a light yellow beverage made from clarified cashew juice and sterilized after bottling. It differs from the integral and concentrated juice by the clarification and thermal treatment steps. Many problems such as haze and excessive browning could appear if these steps are not controlled. The objective of this work was divided into two stages with the aim to supply process information in order to obtain a good quality product with uniform characteristics (sensory and nutritional). Polyphenol-protein interaction was studied at the clarification step, which is an empirical process, to provide values on the amount of clarifying solution (gelatin) that must be added to achieve a complete juice clarification. Clarification essays were performed with juice dilutions of 1:2 and 1:10 and the effect of metabissulfite and tannic acid addition was evaluated. It was not possible to establish a clarification point. Metabissulfite did not influenced the clarification process however tannic acid addition displaced the clarification point, showing the difficulty visual monitoring of the process. Thermal treatment of clarified juice was studied at 88, 100, 111 e 121 °C. To evaluate the non-enzymatic browning, vitamin C, 5-hidroximetilfurfural (5-HMF) and sugar variation were correlated with color parameters (reflectance spectra, color difference and CIELAB). Kinetic models were obtained for reflectance spectra, ascorbic acid and 5-HMF. It was observed that 5-HMF introduction followed a first order kinetic rate at the beginning of the thermal treatment and a zero order kinetic at later process stages. An inverse correlation was observed between absorbance at 420 nm and ascorbic acid degradation, which indicates that ascorbic acid might be the principal factor on cajuína non-enzymatic browning. Constant sugar concentration showed that this parameter did not contribute directly to the nonenzymatic browning. Optimization techniques showed showed that to obtain a high vitamin C and a low 5-HMF content, the process must be done at 120 ºC. With the water-bath thermal treatment, the 90 °C temperature promoted a lower ascorbic acid degradation at the expense of a higher 5-HMF level

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this work is the addition of a metallic ion, of the metal Manganese, in a clay of Rio Grande do Norte state for structural ceramics use, the objective this study was to assess the evolution of ceramic properties. The clay was characterized by Chemical and Thermal analysis and Xray difraction. The metallic ion was added in the clay as aqueous solutions at concentrations of 100, 150 and 200 mg / L. The molded by extrusion and the burned were temperatures at 850, 950, 1050 and 1150 º C. Was made Chemical Analysis and investigated the following parameters environmental and ceramic: Solubility, Colour, Linear Retraction (%), Water Absorption (%), Gresification Curves, Apparent Porosity (%), Apparent Specific Mass (g/cm3) and Flexion Rupture Module (kgf/cm2). The results showed that increasing the concentration of metallic ion, properties such as Apparent Porosity (%), Water Absorption (%) decreases and the Flexion Rupture Module (kgf/cm2) increases with increasing temperature independent of the concentration of the ion. The gresification curves showed that the optimum firing temperatures were in the range between 950 and 1050 ° C. The evaluation of the properties showed that the ceramic material can be studied its use in solid brick and ceramic materials with structural function of filling. The results of solubility showed that the addition of ion offers no risk to the environment

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Polymer particles in the nanometer range are of fundamental interest today, especially when used as carrier systems in the controlled release of drugs, cosmetics and nutraceuticals, as well as in coating materials with magnetic properties. The main objective of the present study concerns the production of submicron particles of poly (methyl methacrylate) (PMMA) by crystallization of a polymer solution by thermally controlled cooling. In this work, PMMA solutions in ethanol and 1-propanol were prepared at different concentrations (1% to 5% by weight) and crystallized at different cooling rates (0.2 to 0.8 ° C / min) controlled linearly. Analysis of particle size distribution (DLS / CILAS) and scanning electron microscopy (SEM) were performed in order to evaluate the morphological characteristics of the produced particles. The results demonstrated that it is possible to obtain submicron polymer perfectly spherical particles using the technique discussed in this study. It was also observed that, depending on the cooling rate and the concentration of the polymer solution, it is possible to achieve high yield in the formation of submicron particles. In addition, preliminary tests were performed in order to verify the ability of this technique to form particulated carrier material with magnetic properties. The results showed that the developed technique can be an interesting alternative to obtain polymer particles with magnetic properties

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Drying of fruit pulps in spouted beds of inert particles has been indicated as a viable technique to produce fruit powders. Most of the processes employed to produce dried fruit pulps and juices, such as Foam Mat, encapsulation by co-crystallization and spray drying utilize adjuvant and additives (such as thickeners, coating materials, emulsifiers, acidulants, flavors and dyes), which is not always desirable. The fruit pulp composition exerts an important effect on the fruit powder production using a spouted bed. In the study by Medeiros (2001) it was concluded that lipids, starch and pectin contents play an important role on the process performance, enhancing the powder production; however, the drying of fruit pulps containing high content of reducing sugars (glucose and fructose) is practically unviable. This work has the objective of expanding the studies on drying of fruit pulps in spouted bed with aid of adjuvant (lipids, starch and pectin) aiming to enhance the dryer performance without jeopardizing the sensorial quality of the product. The optimum composition obtained by Medeiros (2001) was the basis for preparing the mixtures of pulps. The mixture formulations included pulps of mango (Mangifera indica), umbu (Spondias tuberosa) and red mombin (Spondia purpurea) with addition of cornstarch, pectin and lipids. Different products were used as lipids source: olive and Brazil nut oils, coconut milk, heavy milk, powder of palm fat and palm olein. First of all, experiments were conducted to define the best formulation of the fruit pulps mixture. This definition was based on the drying performance obtained for each mixture and on the sensorial characteristics of the dry powder. The mixture formulations were submitted to drying at fixed operating conditions of drying and atomizing air flow rate, load of inert particles, temperature and flow rate of the mixture. The best results were obtained with the compositions having powder of palm fat and palm olein in terms of the drying performance and sensorial analysis. Physical and physicochemical characteristics were determined for the dry powders obtained from the mixtures formulations. Solubility and reconstitution time as well as the properties of the product after reconstitution were also evaluated. According to these analyses, the powder from the mixtures formulations presented similar characteristics and compatible quality to those produced in other types of dryers. Considering that the palm olein is produced in Brazil and that it has been used in the food industry substituting the palm fat powder, further studies on drying performance were conducted with the composition that included the palm olein. A complete factorial design of experiments 23, with three repetitions at the central point was conducted to evaluate the effects of the air temperature, feeding flow rate and intermittence time on the responses related to the process performance (powder collection efficiency, material retained in the bed and angle of repose of the inert particles after the process) and to the product quality (mean moisture content, loss of vitamin C and solubility). Powder production was uniform for the majority of the experiments and the higher efficiency with lower retention in the bed (59.2% and 1.8g, respectively) were obtained for the air temperature of 80°C, mixture feed rate of 5ml/min in intervals of 10 min. The statistical analysis of the results showed that the process variables had individual or combined significant influences on the powder collection efficiency, material retention in the bed, powder moisture content and loss of vitamin C. At the experimental ranges of this work, the angle of repose and solubility were not influenced by the operating variables. From the results of the experimental design, statistical models were obtained for the powder moisture content and loss of vitamin C

Relevância:

10.00% 10.00%

Publicador:

Resumo:

FUNDAMENTO: A hipertensão arterial é uma desordem caracterizada por alterações relevantes no tecido ósseo. O alendronato sódico tem indicação no tratamento de doenças ósseas, por causa de sua afinidade pela hidroxiapatita, inibindo as reabsorções ósseas. OBJETIVO: Analisar a ação local do alendronato sódico na reparação óssea de ratos espontaneamente hipertensos (SHR). MÉTODOS: Um defeito ósseo foi criado no fêmur esquerdo de 80 ratos. de acordo com o material utilizado no local, criaram-se quatro grupos: controle (C), amido (Am), alendronato 1 mol (A1) e alendronato 2 mol (A2). Após 7 e 21 dias, os animais foram sacrificados. Foram realizadas análises histológicas e histomorfométricas e os dados foram submetidos a análise de variância (ANOVA) e teste de Tukey (5%). RESULTADOS: Aos 7 dias, observou-se, na área do defeito, tecido conjuntivo com hemorragia e inflamação em todos os grupos. Alguns apresentavam matriz osteóide. Os grupos A1 e A2 apresentaram, ainda, uma rede de fibrina. Aos 21 dias, as trabéculas ósseas fechavam praticamente a extensão do defeito nos grupos C e Am. No grupo A1 de animais machos, observaram-se trabéculas que se irradiavam do canal medular até a área do defeito. Nos grupos A1 e A2, constatou-se apenas a presença de tecido conjuntivo com mínima deposição de osteóide. Um achado histológico marcante foi a formação de tecido ósseo extracortical subperiosteal nos animais dos grupos A1 e A2. CONCLUSÃO: Concluiu-se que a administração do alendronato sódico não contribuiu para o reparo ósseo nos ratos SHR, mas possivelmente tenha sido responsável pelas formações ósseas extracorticais observadas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neste trabalho, através de simulações computacionais, identificamos os fenômenos físicos associados ao crescimento e a dinâmica de polímeros como sistemas complexos exibindo comportamentos não linearidades, caos, criticalidade auto-organizada, entre outros. No primeiro capítulo, iniciamos com uma breve introdução onde descrevemos alguns conceitos básicos importantes ao entendimento do nosso trabalho. O capítulo 2 consiste na descrição do nosso estudo da distribuição de segmentos num polímero ramificado. Baseado em cálculos semelhantes aos usados em cadeias poliméricas lineares, utilizamos o modelo de crescimento para polímeros ramificados (Branched Polymer Growth Model - BPGM) proposto por Lucena et al., e analisamos a distribuição de probabilidade dos monômeros num polímero ramificado em 2 dimensões, até então desconhecida. No capítulo seguinte estudamos a classe de universalidade dos polímeros ramificados gerados pelo BPGM. Utilizando simulações computacionais em 3 dimensões do modelo proposto por Lucena et al., calculamos algumas dimensões críticas (dimensões fractal, mínima e química) para tentar elucidar a questão da classe de universalidade. Ainda neste Capítulo, descrevemos um novo modelo para a simulação de polímeros ramificados que foi por nós desenvolvido de modo a poupar esforço computacional. Em seguida, no capítulo 4 estudamos o comportamento caótico do crescimento de polímeros gerados pelo BPGM. Partimos de polímeros criticamente organizados e utilizamos uma técnica muito semelhante aquela usada em transições de fase em Modelos de Ising para estudar propagação de danos chamada de Distância de Hamming. Vimos que a distância de Hamming para o caso dos polímeros ramificados se comporta como uma lei de potência, indicando um caráter não-extensivo na dinâmica de crescimento. No Capítulo 5 analisamos o movimento molecular de cadeias poliméricas na presença de obstáculos e de gradientes de potenciais. Usamos um modelo generalizado de reptação para estudar a difusão de polímeros lineares em meios desordenados. Investigamos a evolução temporal destas cadeias em redes quadradas e medimos os tempos característicos de transporte t. Finalizamos esta dissertação com um capítulo contendo a conclusão geral denoss o trabalho (Capítulo 6), mais dois apêndices (Apêndices A e B) contendo a fenomenologia básica para alguns conceitos que utilizaremos ao longo desta tese (Fractais e Percolação respectivamente) e um terceiro e ´ultimo apêndice (Apêndice C) contendo uma descrição de um programa de computador para simular o crescimentos de polímeros ramificados em uma rede quadrada