Synchronous Oral Paracoccidioidomycosis And Pulmonary Tuberculosis In An Immunocompetent Patient.

Paracoccidioidomycosis (PCM) and tuberculosis (TB) are chronic granulomatous infectious diseases, in which the main form of contraction is through inhalation of the microorganism-Paracoccidioides brasiliensis and Mycobacterium tuberculosis. Oral involvement of PCM is observed in up to 70 % of the cases and usually presents clinically as ulcerations with granular surface showing tiny hemorrhagic areas. Oral presentation of TB is rare with prevalence smaller than 0.5 % of all cases. Clinical presentation of oral TB mainly consists of single ulcers with irregular limits and necrotic base. A 70-year-old immunocompetent man presented simultaneously oral PCM and pulmonary TB. Medical history revealed a previous diagnosis of pulmonary TB; however, even under treatment for TB, the patient remained with oral lesions and intense pulmonary fibrosis. The physician requested P. brasiliensis serological analysis, which resulted positive. Although the combination of PCM and TB has been reported in the literature, it is still considered an uncommon condition and their diagnosis may represent a challenge to healthcare professionals because of the similarity between their clinical and radiological presentations.

A Longitudinal Evaluation Of Anti-fviii Antibodies Demonstrated Igg4 Subclass Is Mainly Correlated With High-titre Inhibitor In Haemophilia A Patients.

The development of inhibitory antibodies against factor VIII (FVIII) (inhibitor) is the major complication in haemophilia A patients. The FVIII-binding antibodies development comprises a polyclonal immunoglobulin (Ig) G response. Recent studies showed strong correlation between the presence of neutralizing anti-FVIII antibodies (inhibitors) and IgG4 subclass. The aim of this study was to evaluate anti-FVIII IgG subclasses in haemophilia A patients with inhibitor both in a cross-sectional and in a longitudinal analysis. Inhibitors were determined by Nijmegen-Bethesda assay. Anti-FVIII IgG subclasses were performed by ELISA, and samples from 20 healthy individuals were used to validate the test. We studied 25 haemophilia A patients with inhibitor, previously treated exclusively with plasma-derived FVIII concentrates or bypassing agents. The IgG subclasses distributions were evaluated in two groups of patients classified according to inhibitor response. IgG1 and IgG4 antibodies were most prominent in haemophilia A patients with inhibitors when compared with IgG2 and IgG3. This study reports for the first time the behaviour of FVIII-binding IgG1 and IgG4 subclasses in a longitudinal analysis, in a clinical setting, of high-response inhibitor haemophilia A patients, showing the correlation of IgG4 and the inhibitor titres. In spite of being considered a non-pathologic antibody subclass with anti-inflammatory properties in other situations, IgG4 is correlated with the presence of high-titre inhibitor in the haemophilia setting. The comprehension of the IgG4 role in immune response may be crucial to establish the process for designing specific tolerance to FVIII.

Twin-twin Transfusion Syndrome: Neurodevelopmental Screening Test.

Objective To assess the neurodevelopmental functions (cognition, language and motor function) of survivors of twin-twin transfusion syndrome (TTTS). Method Observational cross-sectional study of a total of 67 monochorionic diamniotic twins who underwent fetoscopic laser coagulation (FLC) for treatment of TTTS. The study was conducted at the Center for Investigation in Pediatrics (CIPED), Universidade Estadual de Campinas. Ages ranged from one month and four days to two years four months. Bayley Scales of Infant and Toddler Development Screening Test-III, were used for evaluation. Results Most children reached the competent category and were classified as having appropriate performance. The preterm children scored worse than term infants for gross motor subtest (p = 0.036). Conclusion The majority of children reached the expected development according to their age. Despite the good neurodevelopment, children classified at risk should be monitored for development throughout childhood.

Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

Estudo dos efeitos de temporada de treinamento físico sobre a Performance de uma equipe de handebol feminino sub-21

Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.

Adaptação de protocolos invasivos e não invasivos para avaliações aeróbias e anaeróbias específicas ao basquetebol feminino

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O aluno portador de visão subnormal na escola regular: desafio para o professor?

Purpose:1) To check self-knowledge and needs for orientation among regular class teachers working with low vision students; 2) To gather information to assist the training on visual deficiency of regular class teachers. Methods: A survey was conducted for the academic year of 1999 among those teachers working in public schools, Campinas/SP/Brazil, of which 11 were municipal and 9 state schools, respectively 79.0% and 90.0% of these schools. A self-administered questionnaire was used as data collection instrument. Results: The sample was composed of 50 teachers with a regular class experience averaging 20 years. Most of them, 94.0%, said that they had no specific preparation in the area of low vision. Only 18 teachers declared to have received some kind of information/orientation in order to work with their low vision students and of those only 15 teachers mentioned the kind of orientation received. The whole group of 50 declared interest in receiving information. From the information/orientation requested 66.0% mentioned extended working class materials, 50.0% visual performance and eye disease of their students and 46.0% visual acuity/visual field. Conclusion: It was detected that teachers of regular classes received none or little information about their low vision students but demonstrated interest in its obtention. It was also shown that those teachers are not prepared to work with visually impaired children.

Comparison between the 1% and 2% ibopamine provocative test in primary open-angle glaucoma patients: sensitivity, specificity and tolerability

PURPOSE: To compare intraocular pressure (IOP) rise in normal individuals and primary open-angle glaucoma patients and the safety and efficacy of ibopamine eye drops in different concentrations as a provocative test for glaucoma. METHODS: Glaucoma patients underwent (same eye) the ibopamine provocative test with two concentrations, 1% and 2%, in a random sequence at least 3 weeks apart, but not more than 3 months. The normal individuals were randomly submitted to one of the concentrations of ibopamine (1% and 2%). The test was considered positive if there was an IOP rise greater than 3 or 4 mmHg at 30 or 45 minutes to test which subset of the test has the best sensitivity (Se)/specificity (Sp). RESULTS: There was no statistically significant difference in any of the IOP measurements, comparing 1% with 2% ibopamine. The IOP was significantly higher at 30 and 45 minutes with both concentrations (p<0.001). The best sensitivity/specificity ratio was achieved with the cutoff point set as greater than 3 mmHg at 45 minutes with 2% ibopamine (area under the ROC curve: 0.864, Se: 84.6%; Sp:73.3%). All patients described a slight burning after ibopamine's instillation. CONCLUSION: 2% ibopamine is recommended as a provocative test for glaucoma. Because both concentrations have similar ability to rise IOP, 1% ibopamine may be used to treat ocular hypotony.

Em jogo a relação entre pesquisador e clube : futebol e processos grupais

Universidade Estadual de Campinas . Faculdade de Educação Física

Influencia de diferentes informações quanto ao tempo de realização do exercicio sobre a atividade eletromiografica e consumo de oxigenio em ciclistas

Universidade Estadual de Campinas . Faculdade de Educação Física

Correlação entre o ponto de compensação respiratoria e desempenho em corredores de rua

Universidade Estadual de Campinas . Faculdade de Educação Física

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Estudos dos desniveis e desvios posturais nas atletas que praticam a modalidade esportiva voleibol

Universidade Estadual de Campinas. Faculdade de Educação Física