Novel efficient technologies in Europe for axle bearing condition monitoring – the MAXBE project

Axle bearing damage with possible catastrophic failures can cause severe disruptions or even dangerous derailments, potentially causing loss of human life and leading to significant costs for railway infrastructure managers and rolling stock operators. Consequently the axle bearing damage process has safety and economic implications on the exploitation of railways systems. Therefore it has been the object of intense attention by railway authorities as proved by the selection of this topic by the European Commission in calls for research proposals. The MAXBE Project (http://www.maxbeproject.eu/), an EU-funded project, appears in this context and its main goal is to develop and to demonstrate innovative and efficient technologies which can be used for the onboard and wayside condition monitoring of axle bearings. The MAXBE (interoperable monitoring, diagnosis and maintenance strategies for axle bearings) project focuses on detecting axle bearing failure modes at an early stage by combining new and existing monitoring techniques and on characterizing the axle bearing degradation process. The consortium for the MAXBE project comprises 18 partners from 8 member states, representing operators, railway administrations, axle bearing manufactures, key players in the railway community and experts in the field of monitoring, maintenance and rolling stock. The University of Porto is coordinating this research project that kicked-off in November 2012 and it is completed on October 2015. Both on-board and wayside systems are explored in the project since there is a need for defining the requirement for the onboard equipment and the range of working temperatures of the axle bearing for the wayside systems. The developed monitoring systems consider strain gauges, high frequency accelerometers, temperature sensors and acoustic emission. To get a robust technology to support the decision making of the responsible stakeholders synchronized measurements from onboard and wayside monitoring systems are integrated into a platform. Also extensive laboratory tests were performed to correlate the in situ measurements to the status of the axle bearing life. With the MAXBE project concept it will be possible: to contribute to detect at an early stage axle bearing failures; to create conditions for the operational and technical integration of axle bearing monitoring and maintenance in different European railway networks; to contribute to the standardization of the requirements for the axle bearing monitoring, diagnosis and maintenance. Demonstration of the developed condition monitoring systems was performed in Portugal in the Northern Railway Line with freight and passenger traffic with a maximum speed of 220 km/h, in Belgium in a tram line and in the UK. Still within the project, a tool for optimal maintenance scheduling and a smart diagnostic tool were developed. This paper presents a synthesis of the most relevant results attained in the project. The successful of the project and the developed solutions have positive impact on the reliability, availability, maintainability and safety of rolling stock and infrastructure with main focus on the axle bearing health.

Collective actions for environmental monitoring and conservation: citizen science, informal environmental education, and participatory approach

This PhD was driven by an interest for inclusive and participatory approaches. The methodology that bridges science and society is known as 'citizen science' and is experiencing a huge upsurge worldwide, in the scientific and humanities fields. In this thesis, I have focused on three topics: i) assessing the reliability of data collected by volunteers; ii) evaluating the impact of environmental education activities in tourist facilities; and iii) monitoring marine biodiversity through citizen science. In addition to these topics, during my research stay abroad, I developed a questionnaire to investigate people's perceptions of natural areas to promote the implementation of co-management. The results showed that volunteers are not only able to collect sufficiently reliable data, but that during their participation in this type of project, they can also increase their knowledge of marine biology and ecology and their awareness of the impact of human behaviour on the environment. The short-term analysis has shown that volunteers are able to retain what they have learned. In the long term, knowledge is usually forgotten, but awareness is retained. Increased awareness could lead to a change in behaviour and in this case a more environmentally friendly attitude. This aspect could be of interest for the development of environmental education projects in tourism facilities to reduce the impact of tourism on the environment while adding a valuable service to the tourism offer. We also found that nature experiences in childhood are important to connect to nature in adulthood. The results also suggest that membership or volunteering in an environmental education association could be a predictor of people's interest in more participatory approaches to nature management. In most cases, the COVID -19 pandemic had not changed participants' perceptions of the natural environment.

Effect Of Simulated Microwave Disinfection On The Linear Dimensional Change, Hardness And Impact Strength Of Acrylic Resins Processed By Different Polymerizing Cycles.

This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A-- water bath at 74ºC for 9 h; B-- water bath at 74ºC for 8 h and temperature increased to 100ºC for 1 h; C-- water bath at 74ºC for 2 h and temperature increased to 100ºC for 1 h;; and D-- water bath at 120ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 sec was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.

Effect Of Simulated Microwave Disinfection On The Linear Dimensional Change, Hardness And Impact Strength Of Acrylic Resins Processed By Different Polymerization Cycles.

This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A) water bath at 74 ºC for 9 h; B) water bath at 74 ºC for 8 h and temperature increased to 100 ºC for 1 h; C) water bath at 74 ºC for 2 h and temperature increased to 100 ºC for 1 h; and D) water bath at 120 ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37 ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 s was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.

Bp-13 Pla2: Purification And Neuromuscular Activity Of A New Asp49 Toxin Isolated From Bothrops Pauloensis Snake Venom.

A new PLA2 (Bp-13) was purified from Bothrops pauloensis snake venom after a single chromatographic step of RP-HPLC on μ-Bondapak C-18. Amino acid analysis showed a high content of hydrophobic and basic amino acids and 14 half-cysteine residues. The N-terminal sequence showed a high degree of homology with basic Asp49 PLA2 myotoxins from other Bothrops venoms. Bp-13 showed allosteric enzymatic behavior and maximal activity at pH 8.1, 36°-45°C. Full Bp-13 PLA2 activity required Ca(2+); its PLA2 activity was inhibited by Mg(2+), Mn(2+), Sr(2+), and Cd(2+) in the presence and absence of 1 mM Ca(2+). In the mouse phrenic nerve-diaphragm (PND) preparation, the time for 50% paralysis was concentration-dependent (P < 0.05). Both the replacement of Ca(2+) by Sr(2+) and temperature lowering (24°C) inhibited the Bp-13 PLA2-induced twitch-tension blockade. Bp-13 PLA2 inhibited the contractile response to direct electrical stimulation in curarized mouse PND preparation corroborating its contracture effect. In biventer cervicis preparations, Bp-13 induced irreversible twitch-tension blockade and the KCl evoked contracture was partially, but significantly, inhibited (P > 0.05). The main effect of this new Asp49 PLA2 of Bothrops pauloensis venom is on muscle fiber sarcolemma, with avian preparation being less responsive than rodent preparation. The study enhances biochemical and pharmacological characterization of B. pauloensis venom.

Supercritical CO2 recovery of caffeine from green coffee oil: new experimental solubility data and modeling

The caffeine solubility in supercritical CO2 was studied by assessing the effects of pressure and temperature on the extraction of green coffee oil (GCO). The Peng-Robinson¹ equation of state was used to correlate the solubility of caffeine with a thermodynamic model and two mixing rules were evaluated: the classical mixing rule of van der Waals with two adjustable parameters (PR-VDW) and a density dependent one, proposed by Mohamed and Holder² with two (PR-MH, two parameters adjusted to the attractive term) and three (PR-MH3 two parameters adjusted to the attractive and one to the repulsive term) adjustable parameters. The best results were obtained with the mixing rule of Mohamed and Holder² with three parameters.

Efeito da temperatura e do teor de umidade na iniciação e desenvolvimento do rizoma de Kohleria eriantha (Benth.) Hanst. (Gesneriaceae)

Kohleria eriantha (Benth.) Hanst is a plant belonging to the family Gesneriaceae, with an underground organ, which is associated with vegetative reproduction. This organ is a rhizome, whose stem bears buds covered with modified leaves that store up starch. In small sections of this rhizome, containing six buds (1.5 to 2.0cm long), only one bud sprouted. The sprouted bud could be differentiated into two morphological pattern: aerial part or rhizome. Sprouting of the rhizome pattern occurred in sections kept on substrate with low water content (1mL of water), or lacking water, whereas sprouting of the aerial part pattern occurred in sections on substrate with high water content (12mL of water). Temperature at 20ºC also stimulated sprouting of the rhizome pattern, regardless of the water volume in the substrate. Sprouting of the rhizome pattern occurred still in sections on substrate to which polyethylene glycol 6000 (PEG) solution was added at the concentrations of 161.2, 235.2 and 340.0g/L, resulting in potentials of -3, -6 and -12 MPa, respectively. Sections kept on substrate with low water content (1 ml of water) showed a reduction in the dry matter content and high osmotic concentration in comparison with those on substrate with high water content. The results obtained revealed that forming of the rhizome pattern was influenced by water content and temperature. It is suggested that sprouting of the rhizome pattern was induced by the low water potential in the sections, when kept on substrate with low water content. Moreover, it was observed that the rhizome buds of Kohleria eriantha showed a high degree of plasticity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Design, construction and evaluation of a simple pressurized solvent extraction system

This work describes the construction and testing of a simple pressurized solvent extraction (PSE) system. A mixture of acetone:water (80:20), 80 ºC and 103.5 bar, was used to extract two herbicides (Diuron and Bromacil) from a sample of polluted soil, followed by identification and quantification by high-performance liquid chromatography coupled with diode array detector (HPLC-DAD). The system was also used to extract soybean oil (70 ºC and 69 bar) using pentane. The extracted oil was weighed and characterized through the fatty acid methyl ester analysis (myristic (< 0.3%), palmitic (16.3%), stearic (2.8%), oleic (24.5%), linoleic (46.3%), linolenic (9.6%), araquidic (0.3%), gadoleic (< 0.3%), and behenic (0.3%) acids) using high-resolution gas chromatography with flame ionization detection (HRGC-FID). PSE results were compared with those obtained using classical procedures: Soxhlet extraction for the soybean oil and solid-liquid extraction followed by solid-phase extraction (SLE-SPE) for the herbicides. The results showed: 21.25 ± 0.36% (m/m) of oil in the soybeans using the PSE system and 21.55 ± 0.65% (m/m) using the soxhlet extraction system; extraction efficiency (recovery) of herbicides Diuron and Bromacil of 88.7 ± 4.5% and 106.6 ± 8.1%, respectively, using the PSE system, and 96.8 ± 1.0% and 94.2 ± 3.9%, respectively, with the SLP-SPE system; limit of detection (LOD) and limit of quantification (LOQ) for Diuron of 0.012 mg kg-1 and 0.040 mg kg-1, respectively; LOD and LOQ for Bromacil of 0.025 mg kg-1 and 0.083 mg kg-1, respectively. The linearity used ranged from 0.04 to 1.50 mg L-1 for Diuron and from 0.08 to 1.50 mg L-1 for Bromacil. In conclusion, using the PSE system, due to high pressure and temperature, it is possible to make efficient, fast extractions with reduced solvent consumption in an inert atmosphere, which prevents sample and analyte decomposition.

Fracionamento dos carboidratos pelas equações do Cornell Net Carbohydrate and Protein System de três cultivares de girassol na presença ou não de irrigação

Objetivou-se quantificar as frações de carboidratos pelas equações do Cornell Net Carbohydrate and Protein System (CNCPS) de três cultivares de girassol (Helianthus annuus L.) cultivados na presença ou não de irrigação. A utilização de uma preparação fibrosa, denominada parede celular (PC), nas equações da CNCPS, em substituição à fibra em detergente neutro (FDN) não promoveu diferenças nas frações de carboidratos B1 e C, mas influenciou as frações A e B2. Como os valores da fração B1, obtidos pelo modelo CNCPS foram menores que os teores de amido e pectina determinados em laboratório, supõe-se que a pectina e outros oligossacarídeos da parede celular, solubilizados pela solução de detergente neutro (fibra solúvel), nunca fizeram parte da fração B1, e sim da fração A. Apesar de os carboidratos da fibra solúvel apresentarem elevadas taxas de degradação, não parece adequada a caracterização da fibra solúvel na fração A. Parece mais adequado que a fibra solúvel (que inclui a pectina) seja alocada a uma fração exclusivamente sua, que pode ser a fração B2, e que seja criada uma nova fração, a B3, para os carboidratos digeríveis da parede celular. Assim, a fração B1 seria composta apenas de amido. A equação da fração C, que estima os carboidratos indigeríveis da parede celular, pode ser simplificada, relacionando a fração indigerível ao teor de lignina na matéria seca, e não à FDN isenta de cinzas e proteína, como atualmente utilizado. Esta proposta tem implicações práticas, uma vez que a fração indigerível da parede celular tem sido expressa em relação à FDN, e não na MS, com base no fato de que os efeitos inibitórios da lignina ocorrem sobre os componentes fibrosos da parede celular vegetal, e não sobre o conteúdo celular.

Survival, population pize, and gonotrophic cycle duration of Nyssomyia neivai (Diptera: Psychodidae) at an endemic area of American Cutaneous Leishmaniasis in Southeastern Brazil

The survival, absolute population size, gonotrophic cycle duration, and temporal and spatial abundance of Nyssomyia neivai (Pinto) were studied in a rural area endemic for American cutaneous leishmaniasis (ACL) in Conchal, Sõo Paulo State, southeastern Brazil, using mark-release-recapture techniques and by monitoring population fluctuation. The monthly abundance exhibited a unimodal pattern, with forest and domicile habitats having the highest relative abundances. A total of 1,873 males and 3,557 females were marked and released during the six experiments, of which 4.1-13.0 per cent of males and 4.1-11.8 per cent of females were recaptured. Daily survivorship estimated from the decline in recaptures per day was 0.681 for males and 0.667 for females. Gonotrophic cycle duration was estimated to be 4.0 d. Absolute population size was calculated using the Lincoln Index and ranged from 861 to 4,612 males and from 2,187 to 19,739 females. The low proportion of females that reach the age when they are potentially infective suggests that N. neivai has a low biological capacity to serve as a vector and that factors such as high biting rates and opportunistic feeding behavior would be needed to enable Leishmania (Viannia) braziliensis Vianna transmission. This agreed with the epidemiological pattern of ACL in southeastern Brazil that is characterized by low incidence, with isolated cases acquired principally within domiciliary habitats

Recovery and upgrading bovine rumen protein by extrusion: effect of lipid content on protein disulphide cross-linking, solubility and molecular weight

Bovine rumen protein with two levels of residual lipids (1.9 per cent or 3.8 per cent) was subjected to thermoplastic extrusion under different temperatures and moisture contents. Protein solubility in different buffers, disulphide cross-linking and molecular weight distribution were determined on the extrudates. After extrusion, samples with 1.9 per cent residual lipids content had a higher concentration of protein insoluble by undetermined forces, irrespective of feed moisture and processing temperature used. Lipid content of 3.8 per cent in the feed material resulted in more protein participating in the extrudate network through non-covalent interactions (hydrophobic and electrostatic) and disulphide bonds. A small dependency of the extrusion process on moisture and temperature and a marked dependency on lipid content, especially phospholipid, was observed, Electrophoresis under non-reducing conditions showed that protein extrusion with low feed moisture promoted high molecular breakdown inside the barrel, probably due to intense shear force, and further protein aggregation at the die end

Optimization of the Enzymatic Interesterification of Milk Fat and Canola Oil Blends Using Immobilized Rhizopus oryzae Lipase by Response Surface Methodology

Blends of milk fat and canola oil (MF:CNO) were enzymatically interesterified (EIE) by Rhizopus oryzne lipase immobilized on polysiloxane-polyvinyl alcohol (SiO(2)-PVA) composite, in a solvent-free system. A central composite design (CCD) was used to optimize the reaction, considering the effects of different mass fractions of binary blends of MF:CNO (50:50, 65:35 and 80:20) and temperatures (45, 55 and 65 degrees C) on the composition and texture properties of the interesterified products, taking the interesterification degree (ID) and consistency (at 10 degrees C) as response variables. For the ID variable both mass fraction of milk fat in the blend and temperature were found to be significant, while for the consistency only mass fraction of milk fat was significant. Empiric models for ID and consistency were obtained that allowed establishing the best interesterification conditions: blend with 65 % of milk fat and 35 %, of canola oil, and temperature of 45 degrees C. Under these conditions, the ID was 19.77 %) and the consistency at 10 degrees C was 56 290 Pa. The potential of this eco-friendly process demonstrated that a product could be obtained with the desirable milk fat flavour and better spreadability under refrigerated conditions.

Lsa21, a novel leptospiral protein binding adhesive matrix molecules and present during human infection

Background: It has been well documented over past decades that interaction of pathogens with the extracellular matrix (ECM) plays a primary role in host cell attachment and invasion. Adherence to host tissues is mediated by surface-exposed proteins expressed by the microorganisms during infection. The mechanisms by which pathogenic leptospires invade and colonize the host remain poorly understood since few virulence factors contributing to the pathogenesis of the disease have been identified. Whole-genome sequencing analysis of L. interrogans allowed identification of a repertoire of putative leptospiral surface proteins. Results: Here, we report the identification and characterization of a new leptospiral protein that exhibits extracellular matrix-binding properties, called as Lsa21 (leptospiral surface adhesin, 21 kDa). Compatible with its role in adhesion, the protein was shown to be surface-exposed by indirect immunofluorescence. Attachment of Lsa21 to laminin, collagen IV, and plasma fibronectin was specific and dose dependent. Laminin oxidation by sodium metaperiodate reduced the protein-laminin interaction in a concentration-dependent manner, indicating that laminin sugar moieties are crucial for this interaction. The gene coding for Lsa21 is present in pathogenic strains belonging to the L. interrogans species but was not found in the saprophytic L. biflexa serovar Patoc strain Patoc 1. Loss of gene expression occurs upon culture attenuation of pathogenic strains. Environmental factors such as osmolarity and temperature affect Lsa21 expression at the transcriptional level. Moreover, anti-Lsa21 serum labeled liver and kidney tissues of human fatal cases of leptospirosis. Conclusion: Our data suggest a role of Lsa21 in the pathogenesis of leptospirosis.

Influence of a polyclonal antibody preparation on the in situ degradability of three energy sources

The objective of this study was to evaluate the effect of a polyclonal antibody preparation (PAP) against specific ruminal bacteria on the in situ degradability of dry-grounded maize grain (DMG), high moisture maize silage (HMMS) starch and citrus pulp (CiPu) pectin. Nine ruminally cannulated cows were used in a 3 x 3 Latin square design, replicated three times in a factorial arrangement of treatments of two rumen modifiers represented by monensin and PAP plus a control group, and the three energy sources (DMG, HMMS and CiPu). Each period had 21 days, where 16 were used for adaptation to treatment and five for data collection. The group treated with PAP showed an effect on the soluble fraction (""a"") of DMG starch, decreasing it by respectively 45.3% and 45.4% compared to the CON and MON groups. No effect of PAP was observed for any in situ degradability parameters of starch from HMMS or pectin of CiPu. It was concluded that the polyclonal antibody preparation had limited effect on the in situ degradability of the tested energy sources.