941 resultados para Orthogonal polynomials of a discrete variable
Resumo:
OBJETIVO: analisar a insegurança alimentar e o vínculo inadequado mãe-filho como dois potenciais determinantes da desnutrição em crianças de quatro a seis anos de idade. MÉTODOS: estudo de caso-controle desenvolvido em Escolas Municipais de Educação Infantil (EMEIs) no Jardim Jaqueline, área de alta vulnerabilidade social do município de São Paulo, Brasil. Foram aplicados a Escala Brasileira de Insegurança Alimentar e o Protocolo de Avaliação do Vínculo Mãe-filho, além de coletadas informações biológicas e socio-econômicas. Para verificação dos efeitos de cada variável independente e controle dos efeitos das demais variáveis incluídas no modelo, foi utilizado o modelo de regressão logística múltipla. RESULTADOS: verificou-se que tanto a insegurança alimentar familiar (OR=3,6) como o vínculo inadequado mãe-filho (OR=9,4) estiveram associados com a desnutrição infantil (p<0,05), mesmo após o controle para o peso ao nascimento da criança e idade, estado conjugal e trabalho maternos. CONCLUSÕES: tanto a insegurança alimentar familiar (OR=3,6) como o vínculo mãe-filho inadequado (OR=9,4) mostraram-se fatores determinantes da ocorrência da desnutrição na população estudada.
Resumo:
We propose a statistical model to account for the gel-fluid anomalous phase transitions in charged bilayer- or lamellae-forming ionic lipids. The model Hamiltonian comprises effective attractive interactions to describe neutral-lipid membranes as well as the effect of electrostatic repulsions of the discrete ionic charges on the lipid headgroups. The latter can be counterion dissociated (charged) or counterion associated (neutral), while the lipid acyl chains may be in gel (low-temperature or high-lateral-pressure) or fluid (high-temperature or low-lateral-pressure) states. The system is modeled as a lattice gas with two distinct particle types-each one associated, respectively, with the polar-headgroup and the acyl-chain states-which can be mapped onto an Ashkin-Teller model with the inclusion of cubic terms. The model displays a rich thermodynamic behavior in terms of the chemical potential of counterions (related to added salt concentration) and lateral pressure. In particular, we show the existence of semidissociated thermodynamic phases related to the onset of charge order in the system. This type of order stems from spatially ordered counterion association to the lipid headgroups, in which charged and neutral lipids alternate in a checkerboard-like order. Within the mean-field approximation, we predict that the acyl-chain order-disorder transition is discontinuous, with the first-order line ending at a critical point, as in the neutral case. Moreover, the charge order gives rise to continuous transitions, with the associated second-order lines joining the aforementioned first-order line at critical end points. We explore the thermodynamic behavior of some physical quantities, like the specific heat at constant lateral pressure and the degree of ionization, associated with the fraction of charged lipid headgroups.
Resumo:
We investigate the performance of a variant of Axelrod's model for dissemination of culture-the Adaptive Culture Heuristic (ACH)-on solving an NP-Complete optimization problem, namely, the classification of binary input patterns of size F by a Boolean Binary Perceptron. In this heuristic, N agents, characterized by binary strings of length F which represent possible solutions to the optimization problem, are fixed at the sites of a square lattice and interact with their nearest neighbors only. The interactions are such that the agents' strings (or cultures) become more similar to the low-cost strings of their neighbors resulting in the dissemination of these strings across the lattice. Eventually the dynamics freezes into a homogeneous absorbing configuration in which all agents exhibit identical solutions to the optimization problem. We find through extensive simulations that the probability of finding the optimal solution is a function of the reduced variable F/N(1/4) so that the number of agents must increase with the fourth power of the problem size, N proportional to F(4), to guarantee a fixed probability of success. In this case, we find that the relaxation time to reach an absorbing configuration scales with F(6) which can be interpreted as the overall computational cost of the ACH to find an optimal set of weights for a Boolean binary perceptron, given a fixed probability of success.
Resumo:
No-till (NT) adoption is an essential tool for development of sustainable agricultural systems, and how NT affects the soil organic C (SOC) dynamics is a key component of these systems. The effect of a plow tillage (PT) and NT age chronosequence on SOC concentration and interactions with soil fertility were assessed in a variable charge Oxisol, located in the South Center quadrant of Parana State, Brazil (50 degrees 23`W and 24 degrees 36`S). The chronosequence consisted of the following six sites: (i) native field (NF); (ii) PT of the native field (PNF-1) involving conversion of natural vegetation to cropland; (iii) NT for 10 years (NT-10); (iv) NT for 20 years (NT-20); (v) NT for 22 years (NT-22); and (vi) conventional tillage for 22 years (CT-22) involving PT with one disking after summer harvest and one after winter harvest to 20 cm depth plus two harrow disking. Soil samples were collected from five depths (0-2.5; 2.5-5; 5-10; 10-20; and 20-40 cm) and SOC, pH (in H(2)O and KCl), Delta pH, potential acidity, exchangeable bases, and cation exchangeable capacity (CEC) were measured. An increase in SOC concentration positively affected the pH, the negative charge and the CEC and negatively impacted potential acidity. Regression analyses indicated a close relationship between the SOC concentration and other parameters measured in this study. The regression fitted between SOC concentration and CEC showed a close relationship. There was an increase in negative charge and CEC with increase in SOC concentration: CEC increased by 0.37 cmol(c) kg(-1) for every g of C kg(-1) soil. The ratio of ECEC:SOC was 0.23 cmol(c) kg(-1) for NF and increased to 0.49 cmol(c) kg(-1) for NT-22. The rates of P and K for 0-10 cm depth increased by 9.66 kg ha(-1) yr(-1) and 17.93 kg ha(-1) yr(-1), respectively, with NF as a base line. The data presented support the conclusion that long-term NT is a useful strategy for improving fertility of soils with variable charge. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
A general, fast wavelet-based adaptive collocation method is formulated for heat and mass transfer problems involving a steep moving profile of the dependent variable. The technique of grid adaptation is based on sparse point representation (SPR). The method is applied and tested for the case of a gas–solid non-catalytic reaction in a porous solid at high Thiele modulus. Accurate and convergent steep profiles are obtained for Thiele modulus as large as 100 for the case of slab and found to match the analytical solution.
Resumo:
The literature examining purported relationships between ownership of companion animals and health is extremely heterogeneous. While much of the descriptive literature tends to support benefits of animal companionship, large scale, controlled research yields inconsistent and even contradictory findings on several issues, including associations with cardiovascular disease, mood and wellbeing. In an analysis of a large longitudinal data-set from the Australian Longitudinal Study on Women's Health, a prospective study of a nationally representative sample of more than 12,000 older women, difficulties with disentangling the effects of powerful demographic variables and age-related factors from the specific effects of pet ownership became apparent. Both cross-sectional and longitudinal analyses demonstrated that associations between mental and physical health and pet ownership as well as changes in pet ownership over time were weak and inconsistent compared to the large effects of living arrangements and other demographic variables. As sociodemographic variables relate strongly to both health and opportunities for pet ownership, this high level of confounding means it is unlikely that the impact of the specific variable of pet ownership on health can be ascertained from such studies. Rather, well-designed experimental studies, wherein the majority of such confounding variables can be held constant or at least somewhat controlled, are needed.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
A continuum model for regular block structures is derived by replacing the difference quotients of the discrete equations by corresponding differential quotients. The homogenization procedure leads to an anisotropic Cosserat Continuum. For elastic block interactions the dispersion relations of the discrete and the continuous models are derived and compared. Yield criteria for block tilting and sliding are formulated. An extension of the theory for large deformation is proposed. (C) 1997 by John Wiley & Sons, Ltd.
Resumo:
Purpose: To evaluate the ability of the GDx Variable Corneal Compensation (VCC) Guided Progression Analysis (GPA) software for detecting glaucomatous progression. Design: Observational cohort study. Participants: The study included 453 eyes from 252 individuals followed for an average of 46 +/- 14 months as part of the Diagnostic Innovations in Glaucoma Study. At baseline, 29% of the eyes were classified as glaucomatous, 67% of the eyes were classified as suspects, and 5% of the eyes were classified as healthy. Methods: Images were obtained annually with the GDx VCC and analyzed for progression using the Fast Mode of the GDx GPA software. Progression using conventional methods was determined by the GPA software for standard automated achromatic perimetry (SAP) and by masked assessment of optic disc stereophotographs by expert graders. Main Outcome Measures: Sensitivity, specificity, and likelihood ratios (LRs) for detection of glaucoma progression using the GDx GPA were calculated with SAP and optic disc stereophotographs used as reference standards. Agreement among the different methods was reported using the AC(1) coefficient. Results: Thirty-four of the 431 glaucoma and glaucoma suspect eyes (8%) showed progression by SAP or optic disc stereophotographs. The GDx GPA detected 17 of these eyes for a sensitivity of 50%. Fourteen eyes showed progression only by the GDx GPA with a specificity of 96%. Positive and negative LRs were 12.5 and 0.5, respectively. None of the healthy eyes showed progression by the GDx GPA, with a specificity of 100% in this group. Inter-method agreement (AC1 coefficient and 95% confidence intervals) for non-progressing and progressing eyes was 0.96 (0.94-0.97) and 0.44 (0.28-0.61), respectively. Conclusions: The GDx GPA detected glaucoma progression in a significant number of cases showing progression by conventional methods, with high specificity and high positive LRs. Estimates of the accuracy for detecting progression suggest that the GDx GPA could be used to complement clinical evaluation in the detection of longitudinal change in glaucoma. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references. Ophthalmology 2010; 117: 462-470 (C) 2010 by the American Academy of Ophthalmology.
Resumo:
We demonstrate that a system obeying the complex Lorenz equations in the deep chaotic regime can be controlled to periodic behavior by applying a modulation to the pump parameter. For arbitrary modulation frequency and amplitude there is no obvious simplification of the dynamics. However, we find that there are numerous windows where the chaotic system has been controlled to different periodic behaviors. The widths of these windows in parameter space are narrow, and the positions are related to the ratio of the modulation frequency of the pump to the average pulsation frequency of the output variable. These results are in good agreement with observations previously made in a far-infrared laser system.
Resumo:
We study the continuous problem y"=f(x,y,y'), xc[0,1], 0=G((y(0),y(1)),(y'(0), y'(1))), and its discrete approximation (y(k+1)-2y(k)+y(k-1))/h(2) =f(t(k), y(k), v(k)), k = 1,..., n-1, 0 = G((y(0), y(n)), (v(1), v(n))), where f and G = (g(0), g(1)) are continuous and fully nonlinear, h = 1/n, v(k) = (y(k) - y(k-1))/h, for k =1,..., n, and t(k) = kh, for k = 0,...,n. We assume there exist strict lower and strict upper solutions and impose additional conditions on f and G which are known to yield a priori bounds on, and to guarantee the existence of solutions of the continuous problem. We show that the discrete approximation also has solutions which approximate solutions of the continuous problem and converge to the solution of the continuous problem when it is unique, as the grid size goes to 0. Homotopy methods can be used to compute the solution of the discrete approximation. Our results were motivated by those of Gaines.
Resumo:
Neste trabalho, analisa-se a trajet??ria dos programas de transfer??ncia de renda no sistema de prote????o social brasileiro, procurando demonstrar como algumas quest??es federativas t??m afetado decisivamente a sua implementa????o, desde as primeiras iniciativas subnacionais at?? a ado????o de programas nacionais com clara interface intergovernamental. O argumento central ?? que o modelo federativo influenciou diretamente o desenvolvimento dos programas de transfer??ncia de renda no Brasil, sendo determinante para o seu bom desempenho.
Resumo:
A absorção de água por carcaças de frango na etapa de pré-resfriamento da linha abate representa uma característica de qualidade importante relacionada ao rendimento do produto final. Uma forma de manter o padrão de qualidade de um produto é garantir que as etapas do processo sejam estáveis e replicáveis. Ao empregar o Controle Estatístico de Processo (CEP) é possível obter estabilidade e melhorias nos processos, por meio da redução da variabilidade. Neste contexto, o objetivo deste trabalho foi a aplicação de gráficos de controle, análise de correlação, estatística descritiva, testes de hipóteses e regressão linear múltipla na linha de abate de um abatedouro-frigorífico de aves para monitorar a variabilidade da absorção de água pelas carcaças de frango após a etapa de pré-resfriamento. Como resultado, verificou-se que o teor de absorção de água das carcaças de frango apresentou elevada variabilidade, sendo que 10% (8/80) das carcaças apresentaram absorção de água superior ao limite de 8% definido pela legislação brasileira. Do total de 16 variáveis de entrada analisadas, as mais impactantes no teor de absorção de água foram o “tempo de retenção da carcaça no pré-chiller” e o “tempo de espera da carcaça após a etapa de gotejamento”. Entretanto, o modelo de regressão obtido apresentou baixa correlação (R²=0,16) que foi associada à elevada variabilidade da variável-resposta. Os resultados da estatística descritiva demonstraram que as variáveis de entrada também apresentaram elevada variabilidade, com coeficiente de variação entre 7,95 e 63,5%. Verificou-se, pela análise dos gráficos de controle de medida individual e da amplitude móvel, que 15 das 16 variáveis de entrada se apresentaram fora de controle estatístico assim como a variável-resposta. Baseado no fluxograma e na descrição das etapas da linha de abate, previamente realizados, atribuiu-se à falta de padronização na condução das etapas e de procedimentos para o controle de qualidade das operações na linha de abate como fatores relevantes que poderiam estar associados à presença de causas especiais no processo. Concluiu-se que para reduzir a elevada variabilidade das variáveis e eliminar as causas especiais presentes são necessários ajustes operacionais para, dessa forma, obter um processo mais estável e mais uniforme garantindo o padrão de qualidade das carcaças de frango em relação ao teor de absorção de água.
Resumo:
O presente trabalho objetiva avaliar o desempenho do MECID (Método dos Elementos de Contorno com Interpolação Direta) para resolver o termo integral referente à inércia na Equação de Helmholtz e, deste modo, permitir a modelagem do Problema de Autovalor assim como calcular as frequências naturais, comparando-o com os resultados obtidos pelo MEF (Método dos Elementos Finitos), gerado pela Formulação Clássica de Galerkin. Em primeira instância, serão abordados alguns problemas governados pela equação de Poisson, possibilitando iniciar a comparação de desempenho entre os métodos numéricos aqui abordados. Os problemas resolvidos se aplicam em diferentes e importantes áreas da engenharia, como na transmissão de calor, no eletromagnetismo e em problemas elásticos particulares. Em termos numéricos, sabe-se das dificuldades existentes na aproximação precisa de distribuições mais complexas de cargas, fontes ou sorvedouros no interior do domínio para qualquer técnica de contorno. No entanto, este trabalho mostra que, apesar de tais dificuldades, o desempenho do Método dos Elementos de Contorno é superior, tanto no cálculo da variável básica, quanto na sua derivada. Para tanto, são resolvidos problemas bidimensionais referentes a membranas elásticas, esforços em barras devido ao peso próprio e problemas de determinação de frequências naturais em problemas acústicos em domínios fechados, dentre outros apresentados, utilizando malhas com diferentes graus de refinamento, além de elementos lineares com funções de bases radiais para o MECID e funções base de interpolação polinomial de grau (um) para o MEF. São geradas curvas de desempenho através do cálculo do erro médio percentual para cada malha, demonstrando a convergência e a precisão de cada método. Os resultados também são comparados com as soluções analíticas, quando disponíveis, para cada exemplo resolvido neste trabalho.
Resumo:
No âmbito da condução da política monetária, as funções de reação estimadas em estudos empíricos, tanto para a economia brasileira como para outras economias, têm mostrado uma boa aderência aos dados. Porém, os estudos mostram que o poder explicativo das estimativas aumenta consideravelmente quando se inclui um componente de suavização da taxa de juros, representado pela taxa de juros defasada. Segundo Clarida, et. al. (1998) o coeficiente da taxa de juros defasada (situado ente 0,0 e 1,0) representaria o grau de inércia da política monetária, e quanto maior esse coeficiente, menor e mais lenta é a resposta da taxa de juros ao conjunto de informações relevantes. Por outro lado, a literatura empírica internacional mostra que esse componente assume um peso expressivo nas funções de reação, o que revela que os BCs ajustam o instrumento de modo lento e parcimonioso. No entanto, o caso brasileiro é de particular interesse porque os trabalhos mais recentes têm evidenciado uma elevação no componente inercial, o que sugere que o BCB vem aumentando o grau de suavização da taxa de juros nos últimos anos. Nesse contexto, mais do que estimar uma função de reação forward looking para captar o comportamento global médio do Banco Central do Brasil no período de Janeiro de 2005 a Maio de 2013, o trabalho se propôs a procurar respostas para uma possível relação de causalidade dinâmica entre a trajetória do coeficiente de inércia e as variáveis macroeconômicas relevantes, usando como método a aplicação do filtro de Kalman para extrair a trajetória do coeficiente de inércia e a estimação de um modelo de Vetores Autorregressivos (VAR) que incluirá a trajetória do coeficiente de inércia e as variáveis macroeconômicas relevantes. De modo geral, pelas regressões e pelo filtro de Kalman, os resultados mostraram um coeficiente de inércia extremamente elevado em todo o período analisado, e coeficientes de resposta global muito pequenos, inconsistentes com o que é esperado pela teoria. Pelo método VAR, o resultado de maior interesse foi o de que choques positivos na variável de inércia foram responsáveis por desvios persistentes no hiato do produto e, consequentemente, sobre os desvios de inflação e de expectativas de inflação em relação à meta central.